Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

1% 1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAR1972.3                           14 END     13          3       92                (no blast hit)

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     2 128.0    0(repeat)                                    0 REP     83       1960     2467                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012070150 Xt7.1-CAAR9388.3 - 330 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAR9388.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAGTGAATAAGAGGCTTGCTGGCAAATTGAACATAAAGGAAAACTATACCCCAGAAGGAATACCTAACCAGCAGTTTATATCATGTTAAGTGGCCTATTACAGAATCTCTCCAAACTGGAATATATATATCAGTAAATATTGCCCTTTTACTTCCTTTCCCTTGAGCCGCCATTTTGTAATGGGCTGTGTGCTCCCTCAGAGATCAGCTGACAGGAAATAATGCAGCTCTAACTGTAACAGGAAGTAGTGTGGGAGAACTCTGTCCATAAATTGTTTGATGGGGCCTAGCATGTATGTGTGCCTTGGCTTGTTTGTGTGCACTGTGAATCCTCTGATCCCAGGGGGTGGCCCTTTATTCTTAAAATGGCAATTTTCTATTTAGGAGTACCCAATAGCACATACTACTAAAAATGTATATTTTTATGAAAATGATTTATTTAGAGGAAGCAGGAGTTTACAAATGAAATTGTTCATGCAGTATATTTTTATAGAGACCTACATTGTTTGGGGGTATAGTTTTCCTTTAAAGGCTGAGAAACTTTTCTGTTTTTAATAGAGCGCCCAAACATTTAATTTTTATATACCATGCTATATATGTGTATATGGGTAAATAAATATTTTTGATTTAGTGAAAGCAGTATTTGTGCAGTTGTTTTCACACTGCTTGGTATGCACCTCTATATATACTGTATATATATATATATATAATGTAGGCCCAATATGCCAGCAGTCTGTAGAGCTCACATCTTGAGTAAAAAAGACCCTAAATCTGAGCAGGAGATTTATTAACTATTGTCAACGAGGGATGCACAGAACCCAGTTTTTCAGATTTGGCCGAATACCAAACCGAATCCCAATAAGCTTACGCTATTTCGTTTTTTGAATGGTTAAATGTCGCCGCGCGAAGTAGAAAAAATTCTACTTCCGCATTCATGTGGTGACATTTAGGTTCGGCCGAGACCGTGGATTCAGCCAATTCCGAACCCTGCTGAAAAAGGCAGAATACCTAATCCTGGATTCAGTGCATCCGTATTGTTAACCCTTTATGAGCAGTACTGATGCATGCTACTTGTTAAAGAGTTAATGATAGTTTCATGTTCAAAATAAAATGGCC
                                                  Xt7.1-CHK-1008221448                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAGTGAATAAGAGGCTTGCTGGCAAATTGAACATAAAGGAAAACTATACCCCAGAAGGAATACCTAACCAGCAGTTTATATCATGTTAAGTGGCCTATTACAGAATCTCTCCAAACTGGAATATATATATCAGTAAATATTGCCCTTTTACTTCCTTTCCCTTGAGCCGCCATTTTGTAATGGGCTGTGTGCTCCCTCAGAGATCAGCTGACAGGAAATAATGCAGCTCTAACTGTAACAGGAAGTAGTGTGGGAGAACTCTGTCCATAAATTGTTTGATGGGGCCTAGCATGTATGTGTGCCTTGGCTTGTTTGTGTGCACTGTGAATCCTCTGATCCCAGGGGGTGGCCCTTTATTCTTAAAATGGCAATTTTCTATTTAGGAGTACCCAATAGCACATACTACTAAAAATGTATATTTTTATGAAAATGATTTATTTAGAGGAAGCAGGAGTTTACAAATGAAATTGTTCATGCAGTATATTTTTATAGAGACCTACATTGTTTGGGGGTATAGTTTTCCTTTAAAGGCTGAGAAACTTTTCTGTTTTTAATAGAGCGCCCAAACATTTAATTTTTATATACCATGCTATATATGTGTATATGGGTAAATAAATATTTTTGATTTAGTGAxxGCAGTATTTGTGCAGTTGTTTTCACACTGCTTGGTATGCACCTCTATATATACTGTATATATATATATATATAATGTAGGCCCAATATGCCAGCAGTCTGTAGAGCTCACATCTTGAGTAAAAAAGACCCTAAATCTGAGCAGGAGATTTATTAACTATTGTCAACGAGGGATGCACAGAACCCAGTTTTTCAGATTTGGCCGAATACCAAACCGAATCCCAATAAGCTTACGCTATTTCGTTTTTTGAATGGTTAAATGTCGCCGCGCGAAGTAGAAAAAATTCTACTTCCGCATTCATGTGGTGACATTTAGGTTCGGCCGAGACCGTGGATTCAGCCAATTCCGAACCCTGCTGAAAAAGGCAGAATACCTAATCCTGGATTCAGTGCATCCGTATTGTTAACCCTTTATGAGCAGTACTGATGCATGCTACTTGTTAAAGAGTTAATGATAGTTTCATGTTCAAAATAAAATGGCCAAAAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              7    15    10    21    22    27    45    46    70    72    94    96   102   102   102   102   102   102   102   102   102   102   102   102   103   103   103   103   103   103   104   104   104   104   104   104   105   106   106   107   106   108   108   109   107   109   107   109   107   111   108   111   109   113   109   113   109   113   109   113   109   113   110   114   110   114   110   114   111   115   110   115   108   115   108   115   108   115   108   114   108   114   108   114   107   113   108   113   109   114   108   113   109   114   109   114   109   116   109   117   109   117   109   117   109   117   110   120   110   121   109   123   109   124   110   125   109   124   110   125   108   123   110   124   110   124   108   123   106   124    98   115    97   114    93   108    86   107    86   101    72    97    69    95    79    93    77    91    62    79    63    76    54    59    47    52    47    52    46    50    46    50    47    50    47    51    47    52    43    53    45    54    49    58    54    63    58    67    64    73    72    83    76    90   108   127   129   151   132   154   126   154   160   173   164   178   167   179   171   181   174   183   180   188   180   188   179   187   180   187   183   190   181   190   182   190   182   190   182   190   182   190   182   191   180   188   180   188   178   188   180   188   181   188   181   188   178   188   181   186   181   186   179   185   174   182   176   180   176   180   174   180   176   180   174   179   171   178   172   176   172   176   170   175   170   174   169   173   168   173   167   172   163   171   161   166   161   166   162   167   161   167   160   168   160   170   165   170   164   170   164   168   166   169   165   169   166   169   162   167   162   166   162   165   162   164   161   165   160   164   161   164   159   163   158   160   156   159   151   153    42    56    21    27    21    22    21    21    18    20    19    19    18    19    19    19    18    19    17    19    17    19    16    19    17    19    17    19    15    18    15    17    14    17    15    17    15    17    15    17    15    17    15    17    15    16    14    16    15    16    15    16    14    15    14    15    14    15    14    15    14    15    14    15    14    14    14    14    14    14    14    14    14    14    13    13    12    12    12    12    12    12    12    12    11    11    12    12    12    12    12    12    12    12    12    12    12    12    11    12    14    14    14    14    13    13     7    10     4     4     4     4     4     4     3     4     3     4     4     4     3     4     3     4     4     4     3     4     3     3     3     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTAATAGCCAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATTTACGAAAAAAATCGCAAAATACCGATCATTAAGAAAAAATGCATTCGGGCACTTTTCGGACGTTCGTGGATTAGTAAATGTGCCTCTTGGTGTATGAAATAATAATTCTTTTCTGTTACATAGCACGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATGTAAGTCAACATCTATTTTCGATAAGGATATTAAAAAAATATAAGAGTTATGCCCGATGGGAATTGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTGAAACAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A-A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T-G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -A------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------GC
                                               BLH ATG     204     710                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      96     122                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      54      52                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      54      39                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      32      39                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      54      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bb ---- 5e-011     BAC06835.1 Bb-cadherin [Branchiostoma belcheri] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Bf ---- 4e-015     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 4e-017     NP_787974.3 CG33196-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 2e-018     XP_422383.2 PREDICTED: similar to MGC68819 protein [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 4e-022     BAB40596.1 Ci-META1 [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 7e-024     XP_794835.2 PREDICTED: similar to microneme protein 4 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 2e-028     XP_693306.1 PREDICTED: similar to OTTHUMP00000065631 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 3e-031     NP_114141.2 hemicentin 1 [Homo sapiens] -------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Mm ---- 2e-032     XP_891876.2 PREDICTED: similar to hemicentin 1 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 3e-033     NP_509635.2 High Incidence of Males (increased X chromosome loss) family member (him-4) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAH75224.1 MGC84399 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 0          NP_001086392.1 MGC84399 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          AAH81296.1 MGC89178 protein [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAR9388.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGA---TGA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------TGA------------------------TAA------------------------------------TGA------------------------------------------------------------TAA---------------TGA---------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------ATG------------------------------------TAA------------------------TAG------------------------------ATG---------ATG---------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------TAATAG---------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------ATG------------------------------------------------------------------------TGAATG---------------------TAG------------------------------------------------------------------------------------------------------------------------------TAA------ATG---------------------------------TAATGATAG------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   1           Abd0 FL                     IMAGE:7016558.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAAACGTTCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAGTGAATAAGAGGCTTGCTGGCAAATTGAACATAAAGGAAAACTATACCCCAGAAGGAATACCTAACCAGCAGTTTATATCATGTTAAGTGGCCTATTACAGAATCTCTCCAAACTGGAATATATATATCAGTAAATATTGCCCTTTTACTTCCTTTCCCTTGAGCCGCCATTTTGTAATGGGCTGTGTGCTCCCTCAGAGATCAGCTGACAGGAAATAATGCAGCTCTAACTGTAACAGGAAGTAGTGTGGGAGAACTCTGTCCATAAATTGTTTGATGGGGCCTAGCATGTATGTGTGCCTTGGCTTGTTTGTGTGCACTGTGAATCCTCTGATCCCAGGGGGTGGCCCTTTATTCTTAAAATGGCAATTTTCTATTTAGGAGTACCCAATAGCACATACTACTAAAAATGTATATTTTTATGAAAATGATTTATTTAGAGGAAGCAGGAGTTTACAAATGAAATTGTTCATGCAGTATATTTTTATAGAGACCTACATTGTTTGGGGGTATAGTTTTCCTTTAAAGGCTGAGAAACTTTTCTGTTTTTAATAGAGCGCCCAAACATTTAATTTTTATATACCATGCTATATATGTGTATATGGGTAAATAAATATTTTTGATTTAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1       chi AbdN 5x                            IMAGE:7004654                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTTATTATATTATACAACCAACTCTAAAATACATCGCGGGTTTGGGTGACCTATAGAAAAGTTTCGGTTCAGAATCCCGGGATCTTACACAGTCTTCCGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTTAATGGAAGCGAGATGTGTCTTTGGATCCAGATTGTGGTGATGATGAAACAGCAACTTTTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCCATATACCATGGTCGAGTTCAATGATCTGAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGGAATTTCTTTCTAAACCTTAATGCCTACGTAGGTGGCTACTGCCCTGAATATGCAATGGGGGGACTTAAGATGTGCTTTGTGGTATCACCCCACAATTTAATAATCATGGGCCTGAAAGATGCCTTCAGCTAAGGGATATAAATGATGCTCATTTTTCAATAAAATGAAGATAAAAGTCTCTTCATTTAGTGGTTAACACAGCTCCACAAGGGCCAATCTTTTTATATCGGCAAACTGGGCACCTGTGTGTTTCAAGAATACCAAAGGTGGACCCTCCAACCTATTTTCCCACCTATATTTTGTTATGGGGCAAAAATATTTGCCCCTGAAAACTCGGAATCTATTTCTTGAGCGCACCCTAGAATGTAGTTTATACCCAGGCCTTGATATAACACCTCTTTGGTTCCAAGCGAACTACTTTCAGGGAGGCAAGAAGCGGGACCATCATTCTGTCGCGGAATAAAATCACGTGAACCGGTGTGTTCCTAGTGTATTCAAAAATAAGCCCATAACGCATACCCCCTCGCCTGCATAAAGATCTCGCATTTCTCAACCATGGATAAGAGGGCGACTCTATGTCCAGCCGTGTGGGTGAGAACATTGAATATCAATAGTATCCCCGCGGCTCATATTGACACAATCACCCCTGATAAATATCACATAATAGTGTCCTTGGTACTCCCCCCAACCAAACAGAAATCTTGCCACTCCTGCACAAGCTTGGTCATATATAGAGCAAGTACCCCCTCTTGTTAAGAGGGAAATACAAACTGTCTACATGTTCTCAGTCCCGTACACAAATGTCGGCTATGTTGGGGACGCCCGCGCCAATCACCACCTATCGN
  5   1   1         - AbdN 5g3  in                       IMAGE:6998109                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NNGGGGCTGGCATTAACAGTTTCGTCCGGATCCCGGGATGGACAACGTTCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGNGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTG
  5   1   1         - Abd0 5g3  in                     IMAGE:6999630.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACGTTCTGTCTCTTACACAGTCTTACTGAATGTATTTTTTTTACTTTTAATAGCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCCTTGCAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCC
  5   1   1         - Abd0 5g                            IMAGE:6999631                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACGTTCTGTCTCTTACACAGTCTTACTGAATGTATTTTTTTTACTTTTAATAGCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGCCACGTGTATCAGCTCAACTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAGTCTTCACG
  5   1   1         - AbdN 5g                            IMAGE:7021996                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGGAAAACGTTCTGTCTCTTACACAGTCTCCAGAGAATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCCAGAAAAGTTAACTGACTTTGATATGAAC
  5   1   1         - Abd0 5g                            IMAGE:7016341                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAAACGTTCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAG
  5   1   1         - Abd0 FL                            IMAGE:7016558                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAAACGTTCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCT
  5   1   1         - Abd0 5g                            IMAGE:7002843                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACGTTCTGTCTCTTACACAGTCTCCAAGAGATATCGNCTGAAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTANGTTCTGTTATAGCAAGACCTGCAAAGTCTTCT
  5   1   1         - AbdN 5g                            IMAGE:7023929                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAACGTTCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGGAATTGCCAGACTGAGTTTTTGGCACGTGTATCAGCTCAACCTTGCAAGTCTTTGGGAGCGCATTTCGATATGTAGGTTCTGTTTATAGCAAGACCTGCAAAGTCTTCACTGGAAGCTTTTTCTCTGGGAAAATAATGAAATTCCGCCAAGTCCTTTCCGGAATTCTTTTTGCTGGTCCCCCAAAAAAAATTT
  5   1   1         - AbdN 5g                            IMAGE:7025329                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAACGTTCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATACCAAGACCTGCAAAGTCTTCACTGAAGCCTTTTCTCTGGGAGATTATGAGTCCCGGCAGTCATTCCGATTCTTTTGCTGTCCCAGAAAAATTTAACTGACTTTGATAATGGACCACCGAAAGGATCCAATTTTCTTTCTCCAAAAAGTTGGCCTGGAACCAAAATACACGTTCCTGGTGGG
  3  -1   1       chi Abd0      out                      IMAGE:6999050                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACGTTCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGCTTTGCANGCATCACCCCACATTTCATAATCATGGTCCTGACAGATGCCTCAGCTAAAGATTATAATGAAGCAATTTTAATAAATGAAAAAAGTTCCTTATTATTGAACCCAGTCCCAGGCCTCCTTTAGGGCCCTGGCCTTTGTTAAAACAAAGGGACCCCCTTTCCTTTTTTTAGGAAATTCCCAAAATGATTTTGGCCCCTGTAAACCCCCCCCTGAAACTTTGGAGCCCTTTTAAATAGGGTTTTATTAAAAAAACCAAAATCTTCCGGGGTTTTTTGGAAAAAAAACCGGCCCTTCTTN
  5   1   1         - AbdN 5g                            IMAGE:7024021                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACGTTCTGTCTCTTACACAGTCTCCAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAAGTCCGGGCAGTCATTTCTGATTTTCTTTTGCCTGTCCCCT
  5   1   1         - AbdN 5g                            IMAGE:7005626                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTCTGTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGGAGTTAACTGACTTGATAATGACCACCGAAGGGATCATTTCTTCTCTAAAGTTGCTGGAACANATACCACGTCTTGTGGGCATTGAGAAACTGGTTGTGTCCTGAAAAAAGGGGGGGTCCATGTACCCGGCCTGAAAAACCCCCCAAGAAAAGGAAAGCTGGGAAAATAAAATGGTTACCTGG
  5   1   1         - AbdN 5g                            IMAGE:7025473                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCTGTCTCTTACACAGTCTCCAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCCGCAGTCATTCTGAATTCTTTGCTGTCCCAGAGAAATTTACTGACTTGATAATGACCACGGAGGATCAATTTCCTCTCTAAAAGTTGCTGGGACAGATACACTTCCTGTGGCATTGAGGACTGTT
  5   1   1   10    - Liv1 5g3  in                         CAAR8694.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCC
  5   1   1   10    - Liv1 5g3  in                         CAAR6011.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTTGCGGATCCATCGATTGAATTCGGCCGAGGGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCT
  5   1   1       chi Abd0 5x3  in                     IMAGE:6999238.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCTCTTACACAGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCCATGTTGGCTAAGCCCAATATACCCTGGGTCAAAGTTAATGATCCCAGGTATGGGGCCTGTTTAAAAAAAAAAATTTTTGGGAAAAAAATTTGGGAAATTTTTTTTTAAAACTTAAAGGGCCCCAAAAAAGGGGGGCCCCCCCCCCAAAAAAAAAAGGGGGGGGAAAAAAAAAGAGTTTTTTTGGGGGCCCCCCCCCCCCATAAAAAAAAAAAGGTGGGCCCAAAAAAAAATTTTTTTCCAAAAAAAAAAAAAAAAAAACCCCCCTTTTTTAAA
  5   1   1   10    - Liv1 5g3  in                        CAAR11410.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGCTTTTAATAGCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTGCTGGA
  5   1   1         - Liv1      in                         CAAR4035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGAGGCTTTTAATAGCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAAGGATCATTTCTTCTCTAAAGTTGCT
  5   1   1   10    - Liv1 5g3  in                         CAAR9402.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTAATAGCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGNGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAG
  5   1   1         - Abd0 5g                            IMAGE:7018230                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGTCTCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGNGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGNCAAGTCTTCACTGAGGCTTTTCTCT
  5   1   1   10    - Liv1 5g3  in                         CAAR5027.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATCGATTCAATTCGGCCGAGGGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCA
  5   1   1   10    - Liv1 5g3  in                        CAAR11882.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCAATTCGGCACGAGGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCCGAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAG
  5   1   1   10    - Liv1 5g3  in                         CAAR5965.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGNGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGA
  5   1   1   10    - Liv1 5g3  in                         CAAR8023.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCCGAGGAT
  5   1   1   10    - Liv1 5g3  in                        CAAR10379.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTGCTGGACCAGATACA
  5   1   1   10    - Liv1 5g3  in                         CAAR9288.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGAGATATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATA
  5   1   1   20    - Liv1 5g                              CAAR5918.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGCCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAG
  5   1   1   20    - Liv1 5g   ?                         CAAR12696.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAAAAGCCCCAAGAAAGGA
  5   1   1   10    - Liv1 5g3  in                         CAAR3494.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTC
  5   1   1   10    - Liv1 5g3  in                        CAAR10219.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTG
  5   1   1   10    - Liv1 5g3  in                         CAAR3240.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGATTCGGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAAATGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGGAAATAGATGTTACTG
  5   1   1   10    - Liv1 5g3  in                         CAAR4479.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTC
  3  -1   1         - Liv1      in                         CAAR9675.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTG
  3  -1   1         - Liv1      ?                         CAAR11769.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAG
  5   1   1   20    - Liv1 5g                              CAAR9893.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGT
  5   1   1   10    - Liv1 5g3  in                         CAAR6590.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGGCACGAGGAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACT
  5   1   1   10    - Liv1 5g3  in                        CAAR11322.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANNAGTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTG
  5   1   1   10    - Liv1 5g3  in                         CAAR3750.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAANGATCAATTTCTTCTCTAANAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGNTGTGTCTGAAAAATGNGGGTCATGTACCGGCTG
  5   1   1   10    - Liv1 5g3  in                         CAAR3959.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGNGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCAGAGAAGTTACTGACTTGATAATGACCA
  3  -1   1         - Liv1      in                         CAAR6783.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCT
  5   1   1   10    - Liv1 5g3  in                         CAAR7260.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAA
  5   1   1   10    - Liv1 5g3  in                         CAAR7308.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTG
  5   1   1   10    - Liv1 5g3  in                         CAAR8752.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGNGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCC
  5   1   1   10    - Liv1 5g3  in                         CAAR9388.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCCACCGAAGGATCATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTC
  5   1   1   10    - Liv1 5g3  in                         CAAR9881.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCGCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAAGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATA
  5   1   1   10    - Liv1 5g3  in                         CAAR2511.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTTGATATGACCAC
  5   1   1   10    - Liv1 5g3  in                        CAAR10299.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTG
  5   1   1   10    - Liv1 5g3  in                         CAAR7714.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGAAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCT
  3  -1   1         - Liv1      in                         CAAR5322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAAAAAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTGCT
  5   1   1   10    - Liv1 5g3  in                         CAAR2752.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCCTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTNAAAGTTGCT
  5   1   1       chi Liv1 5x3  out                        CAAR6239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAGAATTCATTATGAAACTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCATAATGCCAAGTGCAATCTAGACTGACTATGTATCAGCTCTTGCACATTGGCTACTGGTTGACCAGGAAAGACTTATCTTGTTAAAAACCTCCTGCTGTACCACTAGTTTCATTGTTAAGCCTACGCCTGTAGTGAACGTTAAAAATGATAGAGAATCCAGCTGCTGCTCCTGCTGGCAAG
  3  -1   1         - Liv1      in                          CAAR667.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAAAGAATTATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCT
  5   1   1   10    - Liv1 5g3  in                         CAAR6931.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGA
  5   1   1   10    - Liv1 5g3  in                         CAAR7132.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAG
  3  -1   1         - Liv1      ?                         CAAR10124.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCC
  3  -1   1         - Liv1 PIPE in                        CAAR11928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGNTCCAGAGAAGTTAACTGACTTGATAATG
  5   1   1   10    - Liv1 5g3  in                        CAAR13026.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGNGATCATTTCTTCTCTAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTG
  5   1   1   10    - Liv1 5g3  in                         CAAR6372.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCT
  5   1   1   20    - Liv1 5g   ?                          CAAR7282.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATT
  5   1   1         - Lun1      in                        CABD12917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCC
  5   1   1   10    - Liv1 5g3  in                         CAAR4153.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCT
  3  -1   1         - Liv1      in                          CAAR654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCATGTACCGGCTG
  5   1   1   10    - Liv1 5g3  in                        CAAR11261.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCAT
  5   1   1   10    - Liv1 5g3  in                        CAAR12037.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAGGTGCT
  5   1   1         - Liv1      in                         CAAR1558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGATCCATCGATTCGTTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAT
  5   1   1   20    - Fat1 5g   ?                          CABC7622.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAG
  5   1   1   10    - Liv1 5g3  in                        CAAR11436.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCNGGAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAATGGGGGTCCATGTACCGGCTG
  5   1   1   10    - Liv1 5g3  in                         CAAR1542.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAANGATCAATTTCTTCTCTAAAAGTTGCTGGA
  5   1   1   10    - Liv1 5g3  in                         CAAR4519.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAAACTGTGTGTCTGAAAAATGGGGGGTCATGTACCGGCTG
  5   1   1   10    - Liv1 5g3  in                         CAAR7293.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGA
  5   1   1   10    - Liv1 5g3  in                         CAAR8570.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATTCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTTCTTTGCTG
  5   1   1         - Liv1      in                         CAAR3511.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATCGATTCGTTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCT
  3  -1   1         - Liv1      in                         CAAR4295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTG
  5   1   1   11    - Liv1 5g3  in                         CAAR5077.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCATTATGAAATTTTGCTCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTGCTGGACCAGATACACGTCCTGTGGCATTGAAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTG
  3  -1   1         - Liv1      in                         CAAR5287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATTCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGAC
  3  -1   1         - Liv1      in                        CAAR11826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAANAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAGAAAGGAGCTGGAAATAGATGTACTGG
  5   1   1   10    - Liv1 5g3  in                         CAAR9479.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACC
  5   1   1   10    - Liv1 5g3  in                         CAAR1949.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAAT
  5   1   1   10    - Liv1 5g3  in                        CAAR10606.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTC
  5   1   1         - Liv1      in                          CAAR597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANAGTTGCTGGACCAGATACACGTCCTGTGGCATTG
  5   1   1         - Lun1      in                        CABD13345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTG
  3  -1   1         - Liv1      in                        CAAR11349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCT
  5   1   1         - Liv1                                 CAAR4658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCATCGATTCGCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTG
  5   1   1         - Liv1      ?                         CAAR11685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATG
  3  -1   1         - Liv1      in                         CAAR1984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGGTCATGTACCCGGCTGAAAAGCCCC
  5   1   1         - Liv1                                 CAAR9630.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCT
  5   1   1         - Lun1      in                        CABD10700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAATGNGGGTCCATGTACCGGCTG
  5   1   1         - Liv1      in                         CAAR6626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAATGGGGGTCCAT
  5   1   1         - Liv1      in                        CAAR11361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCC
  5   1   1         - Liv1      in                        CAAR13091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCT
  5   1   1         - Liv1                                CAAR10197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANAGTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCT
  3  -1   1         - Liv1      in                        CAAR13377.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTG
  5   1   1         - Liv1      in                         CAAR2603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCC
  5   1   1         - Liv1      in                         CAAR9818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGT
  5   1   1         - Fat1      in                          CABC922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAANAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAAT
  3  -1   1         - Liv1      in                         CAAR8165.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGCTCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAG
  5   1   1         - Liv1      in                         CAAR1617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGAGGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTG
  5   1   1         - Liv1      in                         CAAR2756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCCAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGGTCATGTACCGGCTG
  5   1   1         - Liv1      in                         CAAR3620.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGAGGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCT
  3  -1   1         - Fat1      in                        CABC10835.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCAGCTTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACGCCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTG
  5   1   1         - Liv1      in                         CAAR5604.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCTTTCTCCTACTCCTCTTCAGCGGCTGGGCATTATCTGCAACTAAATGGAAGCGAGATGTGTCTTTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGA
  3  -1   1         - Liv1      in                         CAAR5797.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGGATCCAGAATGTGGTGATGATGAAACAGCAACTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGNGGGTCCATGTACCGGCTGAGAAGCCCCAAGAA
  5   1   1         - Liv1      in                         CAAR7885.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCAGATGACCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGNGGGTCCATGTACCGGCTGAGAAGCCCCA
  5   1   1         - Fat1      in                          CABC705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAAAGAGTGCCTGCATAGAAAGAGAAGGGATAAAAAATAGAATTTCCTTACTAGACTTTAACAGGTCATGATATTATAATGTCTAAAGATGGAATTCTTCAGATGCAGTATTAGTACCCCTAAGAATGTTTTTGTTACGGGCTGTAGTGTATAGGAGCCCGTAACTGCCAGGAGTAACGTCTTAGCCAGACAGGAGAGACCTGCCAACCCCAGTATTCACCGTTGCCCTTTTGAGCCCCCTGGACTTTCTGAGGTGGGACTGACAGGGATTTTGTATTCTCTGAAAacttgggggcacatttactaatccacgaatccaaatgggaaaaattctgattggaaacgaacattttgtgacgtttttgtattttttgtgatttttccgtcgccgttacgactttttcgtggattgttgtgactttttcgtagccgttgcgacaattagcgcgggtcgtggtgctgctaaagagtcgagacgatttacgaaaaagtcgtggcggctgcgaaaaagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACNNTGATGTCAAATGCCACCCNNTATGCACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGC
  5   1   1         - Liv1      in                         CAAR6512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTTCAACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTCCNAGCACTGCATTGANCACTGATTGTTCAAAAT
  5   1   1         - Liv1                                 CAAR8105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACAGTTAAAGCTGGCCTACACCTGGTTGCTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAA
  5  -1   1         - Liv1      in                         CAAR8370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTACACCGGGTTCCTTAGCACTATTTCTGCTCAGTTTCCATGTGGCGTACGCCAATATCCCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTGACACAGTCACAGGTCATCTT
  5   1   1         - Liv1      in                         CAAR6739.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTAGCACTGTTTCTGCTCAGTTCCCATGTGGCGTACGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTNGACACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGC
  5   1   1         - Liv1      in                        CAAR12342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGANAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGGAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCA
  5   1   1         - Liv1      in                         CAAR9530.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCCAATATACCATGGTCGAGTTTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATAATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTA
  5   1   1         - Fat1      in                         CABC2052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCGATTCGTCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCC
  5   1   1         - Lun1      ?                         CABD10539.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTAATGATCCAGGTATTGGTCCTGTCAGACACACAACTTCTGGAACAGAATTTGGTAATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGA
  5   1   1         - Liv1      ?                         CAAR11915.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATTTCTTTCTAAATCTTAATGCCTACGAAGGTGGCGACTGCCCTGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCCTGCAGTAGTGGGTACATTGCAAAT
  5   1   1         - Liv1      in                          CAAR715.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAATATGCAATGGGTGGACTTAAGATGGCTTTGCAGGCATCACCCCACAATTCAATAATCATGGTCCTGACAGATGCTTCAGCTAAGGATTATAATGATGCCATTTTAATAAATGAGATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGNAGATGAATGTGCTTATTCCTG
  5   1   1         - Liv1 5g3  in                         CAAR3030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ctttttcgtagccgttacgacttgcacgaattgtcgcgactttttcgtagctgttacgatttgctcgtatattgtcgcgactttttcttattgagcgctcgtaaacggcgggcaaaactttcagacttcaggcactctgcagctccaacctggcccaaggaaagtcacgatactgaagcttgaatgaatccaaaactttcgtactcggcgcgacggctacgaaaaagtcgcgacaattagcgcaggtcgtaatgctactaaaaagtcgagacggtttacgaaagagtcgtaacggctacgaaaaagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTG
  5   1   1         - Liv1      in                         CAAR6949.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAAGTCACTTATTAGTGTAACACAGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAA
  5   1   1         - Liv1      in                        CAAR13254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGAGGGTCACAGGTCATCTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAAGTGCATGAGAATG
  5   1   1         - Liv1      in                        CAAR12312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTATGGTCACTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGA
  3  -1   1         - Liv1      in                         CAAR7025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ggcccaaggaaagtcacgatactgaagcttgaatgaatccaaaactttcgtactcggcgcgacggctacgaaaaagtcgcgacaattagcgcgggtcgtgatgctgctaaaaagtcgagacgatttacgaaaaagtcgtggcggctacgagaaagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCT
  5   1   1         - Liv1 5g3  in                        CAAR11736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    gcccaaggaaagtcacgatactgaagcttgaatgaatccaaaactttcgtactcggcgcgacggctacgaaaaagtcgcgacaattggcgcaggtcgtaatgctactaaaaagtcgagacaatttacgaaaaagtcgtgacggctgcgaaaaagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTTAAGGGGATGGATTTGACTGCNAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGGCTGAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCGCCTGGCAGCTAA
  5   1   1         - Liv1      out                        CAAR8262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGCCTTTGTTCAGATACAAGTGACCCAGCATTCACTATTTTTAGGGAAATTGCCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACAT
  5   1   1         - Liv1      in                        CAAR11625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  acgatactgaagcttgaatgaatccaaaactttcgtactcggcgcgacggctacgaaaaagtcgcgacaattggcgcgggtcgtgatgctgctgagaagtcgagacggtttacgggggggtcgtagcggctacgagaaagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATGTAAGTCAACATCTATTTTCGATAAGGATATTAAAAAAATATAAGAGTTATGCCCGATGGGAATTGTGTGGTGAGATAAGTCATTACTTACACTTTGTATCATGAAGACCGACCTTAACAACTGCACCTTGGTGGGTATTTAAAGGGATAGTGACAATTTTCACATTTACCAGGAACATGTGATTGATAAACTAGAGTGCTATTATAGTGACGCACTATTGGCCGTGCTGTCACAGGAGTTGACGTCAGGCTTGAAGACTAATCGACACTGTGTGCCAATCTGAATGTTCTCATCCTGTGTATCACTAGAGGTTTTCTGATGCTTAAATATTACTAGTCTCACCATACTAAAACCTGTGTAACACTAATAAAACAGCGGTTGTTGGATAAG
  5   1   1         - Liv1      in                        CAAR12539.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGGAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGC
  5   1   1         - Liv1      in                         CAAR5527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGACTGAGTTTTGGCCACGTGTATCAGCTCAACCTTGCAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTTGACTGCAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGGCATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAACATCTTGGAATGCTGTCAAT
  5   1   1         - Liv1 5g3  in                         CAAR9868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              cgacggctacgaaagagtcgcgacaattagcgcaggtcgtaatgctactaaaaagtcgagacaatttgcgaaaaagtcgtaacggctacgaaagagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGNCAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAAGTGCATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATC
  5   1   1       chi Liv1      in                         CAAR8584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCGATTCGTGCCCCTCATGAATGCATTGCTGATGAAGCAGGCAGTGCTGTATTCCTTGGTNAGGTTCTACACTCTGTTTTGGAAAACCAAGACCCATGGCACTTCATCTATCTCTCTGTATGTGCAAGGCAGGGCATAAAGTGCAAAAAACATGGTGTAGTGCTACATATTTGGCACTTTGCACCCTGCCTTACACATAGAAAATGACACCTCAAATATCTAAGTGATCCAAAGATTTTGCTTGTACATCACATGGGCCCAAAGAAAATTTATAGTGCTACAATAAAGTGTGGCACCCAACACCCTCAGCCTCATTACTATGCATAATATTTGTTCGTTTATTGTCTTCCCTACTTTATCCAGTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAAGTGCATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAA
  5   1   1         - Liv1 5g3  in                         CAAR3814.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  cgacaattagcgcgggtcgtggtgctactagggagtcgagacagtttacgaagaggtcgtggcggctacgaaagagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTA
  3  -1   1         - Liv1      in                         CAAR8788.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTATAGGGCGAGAGGAAGTCTTGGGAGCGCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCCAGCTAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTA
  3  -1   1         - Liv1      ?                          CAAR7657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGATGCTGCTGaaaagtcgagacaatttacgaaaaagtcgtggcggctacgaaagagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGNCAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAA
  3   1   1       chi Liv1      in                         CAAR4035.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATTTCGATATGTAGGTTCTGTTATAGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTNTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATAGTAAGTAACCTTACCCTCTCTATCCATCTGCGTATGTATCTAGAGGGCTCATTTAATACAGAGGGAAGATGCAAAGGGAAAAAAAGTCCAAACCCCATGGTTTTATGCCCACAATAAAGCTTCTCCCCCACCCAGTATATGTGCCCATCAGTTAATGCAGCAATGGCAGTGTCTGTCTGTGTTGCATGCAGAAGGGTTGTCACATGGATGGGACCTGGAAACCTTGATATACAAGGACAGCAGGATGAGCAAGAGATGCCACAAGGCTTTCCAAAGTCATGTAATTAATGCCTGCTCAGTAGTGATGTGCGGATCAGGAAAAACTCAACCCACACTGGAACAAAACCCACAAAATGTTGACATTCTAAGCCCTGCATCCAACCCATACCCACATATTTTCTGCTCTGTATGCTACTTCTGTGTGCACTTCCTTTTCCAATACAGTTTTTTGGATATATATAGAACCCATAActatacaggtataggacccattatccagaatgctcgggaccaagggtattccgggtaaggtgtctttccgtaatttggatctccataccttaagtctactaaaaaatcaataaaacagtaattaaacccaataggatttttttgcatccaataaggattaattatatcttagatggaatcaagtacaaggtactgttttattacAGAGAAAAAAA
  5   1   1         - Liv1                                 CAAR3051.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAAGACCTGCAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGGCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTCTGTTAC
  5   1   1         - Liv1      in                         CAAR6712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      cgaaagagtcgcaacaatttacgaaaaaaatcgcaaaataccgatcattaagaaaaaatgcattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATGTAAGTCAACATCTATTTTCGATAAGGATATTAAAAAAATATAAGAGTTATGCCCGATGGGAATTGTGTGGTGAGATAAGTCATTACTTACACTTTGTATCATGAAGACCGACCTTAACAACTGCACCTTGGTGGGTATTTAAAGGGATAGTGACAATTTTCACATTTACCAGGAACATGTGATTGATAAACTAGAGTGCTATTATAGTGACGCACTATTGGCCGTGCTGTCACAGGAGTTGACGTCAGGCTTGAAGACTAATCGACACTGTGTGCCAATCTGAATGTTCTCATCCTGTGTATCACTAGAGGTTTTCTGATGCTTAAATATTACTAGTCTCACCATACTAAAACCTGTGTAACACTAATAAAACAGCGGTTGTTGGATAAGCCTTCCATTGAGGTTATAGTTGAACCCTTG
  5   1   1         - Liv1      ?                          CAAR6179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGTCTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGNNGGCTCGTTCTGTTACT
  5   1   1         - Liv1      in                        CAAR12811.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAANACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAGGAGAGTGTGGAAACACTGTAGTTA
  5   1   1         - Fat1      in                         CABC5441.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCACTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTTCTGTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAAT
  5   1   1         - Liv1      in                         CAAR1700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAGGCTTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTANAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAGGAGAGT
  5   1   1         - Liv1      in                        CAAR13213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTCTCTGGAGATTATGAGTCCGGCAGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAANACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGC
  5   1   1         - Liv1      in                         CAAR2700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTCATTCTGATTCTTTTGCTGTCCCAGAGAAGTTAACTGACTTGATAATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTCTGTTATTGC
  5   1   1         - Liv1      in                         CAAR8747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  cattcgggcacttttcggacgttcgtggattagtaaatgtgcctcttggtgtaTGAAATAATAATTCTTTTCTGTTACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGACATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGC
  5   1   1         - Fat1      in                         CABC8076.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGACCACCGAAGGATCAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAATTCAGAG
  3  -1   1         - Liv1      in                          CAAR777.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACCACCGAAGGATCAATTTCTTCTCTAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAG
  5   1   1       chi Liv1      in                         CAAR6595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATTTCTTCTCTAAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGAGTGATCCAACCCCTCCCTTACATTGTTCCCTTGTGAAGTGAGGGATCCTGGGACTTTCCAATGAATCTGTTCACCACCCACTATGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAANACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAA
  5   1   1         - Liv1      in                         CAAR1937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGAGGTCTAAAGTTGCTGGACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGT
  5   1   1         - Fat1      in                         CABC7385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCAGATACACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTA
  5   1   1         - Liv1      in                        CAAR11547.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATGTAAGTCAACATCTATTTTCGATAAGGATATTAAAAAAATATAAGAGTTATGCCCGATGGGAATTGTGTGGTGAGATAAGTCATTACTTACACTTTGTATCATGAAGACCGACCTTAACAACTGCACCTTGGTGGGTATTTAAAGGGATAGTGACAATTTTCACATTTACCAGGAACATGTGATTGATAAACTAGAGTGCTATTATAGTGACGCACTATTGGCCGTGCTGTCACAGGAGTTGACGTCAGGCTTGAAGACTAATCGACACTGTGTGCCAATCTGAATGTTCTCATCCTGTGTATCACTAGAGGTTTTCTGATGCTTAAATATTACTAGTCTCACCATACTAAAACCTGTGTAACACTAATAAAACAGCGGTTGTTGGATAAGCCTTCCATTGAGGTTATAGTTGAACCCTTGGTGAAGGCCCTGTTTAGCCAATAACAAGGTTGCAGTTGTATGAAAACACATGCAATATGAACCATTCAGCCATAAGTCCAACAATATAGGGTCACTGACATCCTGATGCTAGTGCTATTTACAAAGCCAGGGTATGACTGCACTCAAGCAACCATAGGGTAAGTGGTAAATACAGGCCCCAGTAATAAACTGCACCAATTGGTACTTGCAGCTGAATAACATGCAGATTAATAGATAGATGGGGATGAAAGGNGGATCATCTATGTATCTCCTTTCCATCTGCCCCTCAATGATGCATTGCTGATGAAACAGGCAGTGCTGT
  5   1   1         - Liv1      in                         CAAR4510.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACATAGCACGTCCTGTGGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGT
  5   1   1         - Liv1      in                         CAAR1108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCATTGAGAACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCACCTTCTATCAGCG
  5   1   1         - Liv1      ?                          CAAR6508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACTGTTGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGNGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACAAATTC
  3  -1   1         - Liv1      in                         CAAR3384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTGTGTCTGAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATGTAAGTCAACATCTATTTTCTATAAGGATATTAAAAAAATATAAGAGTTATGCCCGATGGGAATTGTGTGGTGAGATAAGTCATTACTTACACTTTGTATCATGAAGACCGACCTTAACAACTGCACCTTGGTGGGTATTTAAAGGGATAGTGACAATTTTCACATTTACCAGGAACATGTGATTGATAAACTAGAGTGCTATTATAGTGACGCACTATTGGCCGTGCTGTCACAGGAGTTGACGTCAGGCTTGAAGACTAATCGACACTGTGTGCCAATCTGAATGTTCTCATCCTGTGTATCACTAGAGGTTTTCTGATGCTTAAATATTACTAGTCTCACCATACTAAAACCTGTGTAACACTAATAAAACAGCGGTTGTTGGATAAGCCTTCCATTGAGGTTATAGTTGAACCCTTGGTGAAGGCCCTGTTTAGCCAATAACAAGGTTGCAGTTGTATGAAAACACATGCAATATGAACCATTCAGCCATAAGTCCAACAATATAGGGTCACTGACATCCTGATGCTAGTGCTATTTACAAAGCCAGGGTATGACTGCACTCAAGCAACCATAGGGTAAGTGGTAAATACAGGCCCCAGTAATAAACTGCACCAATTGGTACTTGCAGCTGAATAACATGCAGATTAATAGATAGATGGGGATGAAAGGGGGATCATCTATGTATCTCCTTTCCATCTGCCCCTCATGAATGCATTGCTGATGAAGCAAGCAGTGCTGTATTCCTTGGTGTAGGGTCTACACTCTGTTTTTGGAAAAC
  5   1   1         - AbdN                               IMAGE:7004132                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAAATCAACCTTC
  5   1   1         - Liv1      in                         CAAR7268.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTGTCTGAAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCATTAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAG
  5   1   1         - Liv1      in                         CAAR6020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAGGGAAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTTCTGCACATATATAAATAAAGAAAGTGCGTGAGTGAAAT
  3  -1   1         - Liv1      in                         CAAR7754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAATGGGGGTCCATGTACCGGCTGAGAAGCCCCAAGAAAGGAAGCTGGAAAATAGATGTTACTGGAGAAGGCCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTAT
  5   1   1         - Liv1      in                         CAAR5838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCACATTCTGTACGAGTGGAAGGATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCAC
  5  -1   1       chi Liv1      in                         CAAR5287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTATGATGCCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTATCCCAGCAAGAGAGGAG
  3   1   1         - Liv1      in                         CAAR2700.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTAAAAGTTCCAAGCACTGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCACCCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTC
  5   1   1         - Liv1      in                         CAAR5848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCATTGACAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAAACTAAGA
  5   1   1         - Liv1      ?                          CAAR8323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAACTGATTGTTCAAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGACCATGAAGCCTGATTTATCCCAGTCAGAGAGAAGAACTAAAGAGACCGGAGAAA
  3  -1   1         - Fat1      in                         CABC9253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGNCAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAA
  3   1   1         - Liv1 5g3  in                        CAAR10299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTGAAAC
  3   1   1         - Liv1 5g3  in                         CAAR1949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                         CAAR3959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATGCCACCNTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  5  -1   1         - Liv1      in                         CAAR7025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGCCACCCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTCTTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAG
  3   1   1         - Liv1 5g3  in                         CAAR4153.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCACCTTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCATGGGAATTAGATGCACTGACGAGGATGAATGTGCTATTTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1 5g3  in                         CAAR9388.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTAATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAAAAAAA
  3   1   1         - Liv1      in                         CAAR2756.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATGCACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAAAA
  5  -1   1         - Fat1      in                        CABC10835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAA
  3   1   1         - Fat1      in                         CABC2052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGCACCCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  3   1   1         - Liv1      in                        CAAR12811.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCAACCTGTGAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTGGCAATGGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTAAAGAAAAAAA
  5   1   1         - Lun1      in                        CABD14312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGACTATGATGGCACTAGAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAA
  3   1   1         - Lun1      out                        CABD9968.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCA
  5  -1   1         - Liv1      in                         CAAR4295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAA
  3   1   1         - Liv1      out                        CAAR5537.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAAA
  3   1   1         - Liv1      in                         CAAR1108.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTATTTCCTGGTTAAACAAATGTGNCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAACAAAAAA
  3   1   1         - Lun1      in                        CABD13345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGCAAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                         CAAR6011.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAAAAA
  3   1   1         - Liv1      in                        CAAR11547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCATGGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  5  -1   1         - Liv1      in                         CAAR3384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATGAATGCAAAATAAAAATGGCA
  3   1   1         - Liv1      out                       CAAR10564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGGCACTAAAATCTGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                        CAAR11736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAATCTGCACCTGCAAAGAGGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAA
  3   1   1         - Liv1 5g3  in                         CAAR7308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGCACNTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTAAATGAAAAAA
  3   1   1         - Liv1 5g3  in                         CAAR4479.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTAAAC
  3   1   1         - Liv1 5g3  in                         CAAR7132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCACTGCAAAGAGGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAAA
  3   1   1         - Fat1      in                         CABC8076.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACCTGCAAAGAGGGGGTTCTTTGCAAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      out                       CAAR11883.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTGAAAC
  3   1   1         - Liv1 5g3  in                        CAAR13026.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACCTGCAAAGAGGGGTTCTTTGCAAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      in                        CAAR13254.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTG
  3   1   1         - Liv1 5g3  in                         CAAR3494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAAAA
  3   1   1         - Liv1 5g3  in                         CAAR3814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACCTGCAAAGAGGGGGTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAGG
  3   1   1         - Fat1      out                        CABC6062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTCCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTAA
  3   1   1         - Liv1 5g3  in                         CAAR9479.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACCTGCAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAACAAAAAAAAAAAA
  5   1   1         - Liv1      in                        CAAR10135.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTT
  3   1   1         - Liv1 5g3  in                        CAAR10379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGAGGGGTCTTTTGGCAATGAAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTGAAAC
  3   1   1         - Liv1      in                         CAAR3511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATCCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      out                        CAAR5372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGGGCAAAGCCCTCGGCCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGGGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGGGTCCAACTTGCCGGTACCCGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTTTGTTACTTCGCCTTTAAAGGAAGGAGAGTGGGGAAACCCTGTAGTTAATAATGGAACCCCCCCCCCCTACAGAAACAGATTGTTTGTGGCCCCAAATTCAGAGGGGGGGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCCCATATTTTAATAAAGAAAGG
  3   1   1         - Liv1      in                         CAAR9530.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAAGAGGGGTTCTTTGGCAATGAATTTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTGAAAC
  3   1   1         - Liv1 5g3  in                         CAAR4519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGAGGGGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTATTTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  3   1   1         - Abd0 5x3  in                       IMAGE:6999238                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGTTCNTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTATTCCTGTTAAAACAAATGTGCNGAGGGTACTGTATTTAACACTATTGCTTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTCCTTTTTCT
  3   1   1         - Liv1      out                        CAAR5642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      out                       CAAR10352.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTNGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  3   1   1         - Liv1      in                        CAAR11550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  5   1   1         - Liv1      in                        CAAR11550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTTTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGANATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  5   1   1         - Liv1      in                         CAAR3132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTGAAAACAAAAAAAAAAAAAAAAA
  3   1   1         - Liv1      in                        CAAR11625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGCAATGAAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAAT
  5  -1   1         - Liv1      in                        CAAR13377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCG
  3   1   1         - Liv1 5g3  in                         CAAR3030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1 5g3  in                         CAAR5077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  5  -1   1         - Liv1      in                         CAAR5322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTT
  3   1   1         - Liv1 5g3  in                         CAAR7260.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTT
  3   1   1         - Liv1      out                        CAAR8036.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAAACCTCTCGCCCTATAGG
  3   1   1         - Liv1 5g3  in                        CAAR11261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                         CAAR3750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTAAAC
  3   1   1         - Liv1      in                         CAAR5527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTGAAACAATC
  3   1   1         - Fat1      in                         CABC5441.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAGG
  3   1   1         - Liv1 5g3  in                        CAAR11322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1      out                       CAAR13031.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTTTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1      in                         CAAR1700.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                         CAAR2511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGCATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAGG
  3   1   1         - Liv1      in                         CAAR2603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAATGAATTTAGATGCACTGACGAGGATGAATGTGCTTATCCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAACA
  3   1   1         - Liv1      in                         CAAR3132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAATGAAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  5  -1   1         - Liv1      in                         CAAR9675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATAAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  5  -1   1         - Liv1      in                        CAAR11349.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAA
  3   1   1         - Liv1 5g3  in                        CAAR11410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAGC
  3   1   1         - Liv1      in                         CAAR1617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1      in                         CAAR3620.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  5  -1   1         - Liv1      in                         CAAR7754.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAAT
  5  -1   1         - Fat1      in                         CABC9253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAACCTCGG
  3   1   1         - Lun1      in                        CABD14312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAAGAAAAAAAA
  5  -1   1         - Liv1      in                         CAAR8788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  3   1   1         - Liv1 5g3  in                         CAAR9288.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCCCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  5  -1   1         - Liv1      in                        CAAR11826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAAAA
  3   1   1         - Liv1      in                        CAAR13091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  5  -1   1         - Liv1      out                        CAAR1972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATCCTCGG
  3   1   1         - Liv1      in                          CAAR597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGTTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCAT
  3   1   1         - Liv1 5g3  in                         CAAR6931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGGAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTGAAA
  5   1   1         - Liv1      in                         CAAR8221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTNAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAAAAAAAAAAAAA
  3   1   1         - Liv1      in                          CAAR715.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGAATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGGCAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                         CAAR8694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1 5g3  in                         CAAR9868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAATTAGATGCACTGACGAGGATGAATGTGCTATTTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Abd0 5g3  in                       IMAGE:6999630                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAATTAGATGCTCTGACGAGGATGAATGTGCTATTTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTTTTTGATAAATGCAAAATAAAAGCT
  3   1   1         - Liv1      in                         CAAR6512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATTAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTGCNAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAACAATC
  3   1   1       chi Liv1      in                         CAAR6595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGAGTGATCCAACCCCTCCCTTACATTGTTCCCTTGTGAAGTGAGGGATCCTGGGACTTTCCAATGAATCTGTTCACCACCCACTATGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGAAAAAAA
  3   1   1         - Liv1      in                         CAAR6949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  3   1   1         - Liv1      in                        CAAR13213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAAA
  3   1   1         - Liv1      in                         CAAR5838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTAGATGCACTGACGAGGATGAATGTGCTTATCCTGGTTAAACAAAATGTGCCGAGGGTACTGNTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Fat1      in                          CABC705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTTATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                        CAAR10219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTAGATGCTCTGACGAGGATGAATGTGCTATTTCCTGGTTAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      in                         CAAR6020.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1 5g3  in                         CAAR7293.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGATGCACTGACGAGGATGAATGTGCTTATTCCTGATTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTGAAAC
  3   1   1         - Liv1 5g3  in                         CAAR9881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                        CAAR10606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      in                        CAAR12312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTAAAGAAAAAAAAA
  3   1   1         - Liv1      in                         CAAR1558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      in                         CAAR1937.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                         CAAR6590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTAAAACAAATGTGCCGAGGGTACTGNTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                         CAAR1542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGCACTGACGAGGATGAATGTGCTATTTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  5  -1   1         - Liv1      in                         CAAR1984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      out                        CAAR2540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGATGCTCTGACGAGGATGAATGTGCTTATCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      out                        CAAR5214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGCTCTGACGAGGATGAATGTGCTTATTCCTGGTAAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      ?                          CAAR6452.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGCACTGACGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCGAGAGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1      in                        CAAR11361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  3   1   1         - Liv1      in                        CAAR12539.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGAGGATGAATGTGCTTATTCCTGGTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1 5g3  in                         CAAR2752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGGATGAATGTGCTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - AbdN 5g3  in                       IMAGE:6998109                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCTATTCCTGCTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATGTCTGAAATTTAGCACAATTATTTTTTACCTTTTTCTTCGCGAT
  5   1   1         - Lun1                                CABD14330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTATTCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATCAGTGAATAAGAGGCTTGCTGGCAAATTGAACATAAA
  5  -1   1         - Liv1      in                          CAAR777.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTGGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAAT
  3   1   1         - Liv1      in                         CAAR8221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  5  -1   1         - Panc      out                        CBTA2718.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACTCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAACC
  3   1   1         - Liv1 5g3  in                        CAAR11882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTTTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTA
  3   1   1         - Liv1 5g3  in                        CAAR12037.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  5  -1   1         - Liv1      in                         CAAR5797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTTAAACAAATGTGCGAGGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATG
  3   1   1         - Liv1      in                         CAAR9818.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATTTTGGATATGCTGTCAATGGTGTCCAACTTGCCGGTACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTACTTCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCAACAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGCACAGCTGAACATGAAGCCTGATTTATCCCAGCAAGAGAGAAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTAGCACAATTATTTTTTACCTTTTATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTTTAAATGATC
  3   1   1         - Liv1 5g3  in                        CAAR11436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTAAACAAATGTGCCGAGGGTACTTGTATTAACACTATTGGCTCCTACACGTGTTCTTGCAGTAGTGGGTACATTGCAAATGAAGATCACATTTGTGTTCCTATTGATTACTGTGCAAAGCCCTCGACCAACAAATGCCATGAATATGCCACTTGCACACATACTGGCAGTGGCTACACATGTGCTTGCTCATCTGGATTTAAAGGGGATGGATTTGACTGCAAGTACAGCAAGTGCACAGATATTGCAAGCCTGGACTTTGTGCTGAAGTGCAATGAGAATGAGATGAAAGCTTCGTTTCCAGCCTGCCAGCTAAAACATCTTGGATATGCTGTCAATGGTGTCCAACTTGCAGATACACGGTGCACTGGTGTTGAGGACGCCTTGGGGCTCGTTTCTGTTATTGCGCCTTTAAAGGAAGGAGAGTGTGGAAACACTGTAGTTAATAATGGAACCCACACCACCTACAGAAACAGATTGTTTGTGGCACCAAATTCAGAGGTGGTGGATGCATCAAGCCTAGTCTTTCCAGTTGTAAAGAGATTTTCCTGCACATATATTAATAAAGAAAGTGCGTGAGTGAAATTCAACCTTCTATCAGCGAGATCACTGGGGAAAGCTGAGCATGAAGCCTGATTTATCCCAGCAAGAGAGGAGAACTAAAGAGACAGGAGAAACATAAGAGACCAAGATATTGTCTGAAATTTTGCACAATTATTTTTTACTTTTCATCTTCGCATTTTATTTTTGATAAATGCAAAATAAAAATGGCATTGAAAC
  3   1   1         - Liv1      in                        CAAR12342.3p