Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012070255 Xt7.1-TNeu075a21.3 - 324 ESTs
                                                                       .......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu075a21.3                                                                                                                                                                                                                                                                                                                                                                                                                        GACAGATCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221459                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                             3     3    11    11    11    11    17    18    25    27    36    39    55    57    58    58    58    59    58    59    58    59    59    59    59    59    59    59    60    61    61    61    61    61    61    61    61    61    62    63    61    62    61    62    62    62    62    62    63    64    63    64    63    64    63    64    64    65    64    65    65    66    65    66    66    66    66    66    67    67    67    67    67    67    67    67    68    68    67    68    71    71    71    71    72    72    73    73    75    75    76    76    76    76    76    76    77    77    80    81    80    82    82    84    84    85    84    86    85    86    87    88    88    89    88    89    90    92    92    94    90    92    91    93    91    95    93    95    94    95    91    93    89    92    89    92    92    94    87    92    86    92    77    84    75    81    70    79    70    78    66    73    65    69    60    62    57    61    60    63    58    60    59    61    58    61    58    63    60    63    61    64    61    63    65    65    65    66    64    66    64    66    64    65    63    65    67    69    67    69    67    69    68    69    68    71    68    72    71    74    74    77    75    77    75    77    73    76    73    76    74    77    76    79    77    80    75    79    75    79    74    78    69    72    66    71    64    70    64    69    65    70    65    70    64    70    66    71    68    74    64    70    62    68    63    69    65    70    63    70    65    71    67    74    64    71    65    73    66    73    61    74    63    70    66    75    70    90    77    96    94   120   127   136   140   151   148   158   155   165   171   176   167   176   171   180   173   182   176   184   170   182   178   188   177   188   182   189   183   190   187   192   185   190   184   188   182   187   181   186   181   185   180   184   178   183   177   182   181   183   178   182   179   181   178   180   178   180   179   180   182   183   180   182   180   182   180   182   180   181   178   179   174   175   173   174   171   174   170   172   168   171   168   170   168   170   168   169   167   169   170   171   169   171   167   171   163   170   163   168   162   167   161   166   159   165   160   165   159   165   160   165   156   162   154   160   155   160   154   160   154   161   153   161   153   160   150   159   149   158   149   158   148   157   144   154   141   151   133   141   119   131   110   121    14    25     8     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---G--------
                                               BLH ATG      79     428                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH MIN      58      74                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH OVR      79      51                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               EST CLI      49      27                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               ORF LNG      79       3                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 1e-008     XP_797128.1 PREDICTED: similar to CCAAT/enhancer binding protein (C/EBP), gamma [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 6e-009     NP_523843.1 CG4354-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 1e-015     BAE06337.1 CCAAT enhancer binding protein alpha/gamma homolog [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 5e-032     NP_001026630.1 CCAAT/enhancer binding protein (C/EBP), alpha [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 2e-065     NP_571962.1 CCAAT/enhancer binding protein delta [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 2e-068     NP_031705.3 CCAAT/enhancer binding protein delta [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 9e-070     NP_005186.2 CCAAT/enhancer binding protein delta [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 6e-138     NP_001083078.1 CCAAT-enhancer binding protein delta [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xl ---- 2e-138     AAH97586.1 LOC398729 protein [Xenopus laevis] -------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 1e-163     CAJ81462.1 cebpd, CCAAT/enhancer binding protein (C/EBP), delta [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu075a21.3                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA---------------------TAG------------------------------ATG------------ATG------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TAG---------------------------------------------------------------------------------------------------------------------ATG---------------------------TAG---------------------------------------------------------------------------------------------------TAA---------------------TAA---ATG------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAG---TAA---------------------------------TAG---------------------------TAGTGA------------------------TAA------------------------------------------------------------ATG---------------------------------------------------------TGA---------------------------------------------------------TGA------------------------------------------------------------------------------TGA---TGA---------------------TAA---------------------------------------------------------------------------------------------------------------------------TAA------------------------------TAA------------ATGTAG------------------ATG---------------------ATG---------------------------TAG------------------TGA------------------ATG------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Egg  FL                     TEgg140i20.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAAT
  5   1   1           AbdN FL                     IMAGE:7023521.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                AGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Thy1 5g3  in                        CBST7819.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................GACAGATCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTATGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAGCGCAACAT
  5   1   2   10  bld Limb 5g3  in                        CBSU3261.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................GACAGATCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCC
  5   1   2   10  bld Limb 5g3  in                        CBSU3802.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................GACAGATCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTATGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGG
  5   1   2   10  bld Tail 5g3  in                         CBSW6830.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................CAGATCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTATGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGG
  5   1   2   10  bld Te1  5g3  in                        CBWN12174.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................CAGATCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAA
  5   1   2       bld Abd0 5g                            IMAGE:7015941                                                                                                                                                                                                                                                                                                                                                                                                                            GATCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCNCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAAACATATCGC
  5   1   2       bld Egg  FL                        TEgg140i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTAC
  5   1   2       bld TpA  5g   out                  TTpA031c18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                               CAGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCCAGCTG
  5   1   2       bld Neu0 5g3  in                       IMAGE:6992780                                                                                                                                                                                                                                                                                                                                                                                                                                AGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCANAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAAGCGCACATAGACATGCAGCAGAAGCTGCTCGAACTCTCTTCGGAGAACGAGAAACTGCACAAAAAGATCGGACTTTCTCACCAGGGACTTGAGCAGCCCTCCGGCACTTTCTTCAAACGGCTGCCCCCCCAACGCCAACAGAACCCTTCCTGCCCCAGCCTGA
  5   1   2       bld AbdN FL                            IMAGE:7023521                                                                                                                                                                                                                                                                                                                                                                                                                                AGACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCTGAACTCTCCTCGGAGAACGAGAAAACTGCCCCAAAAAGATCGAAACTTCTTCACCGGGGGACTTTGAGGCAGCCCTTCCCGGCA
  5   1   2   10  bld Spl2 5g3  in                        CBSS2808.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................ACCCAGAGAGCCTGACAGGCAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTATGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTC
  5   1   2   10  bld Spl1 5g3  in                         CABK3397.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCAATTCGGCACGAGGCCTCGTGCCGAATTCGGCACGAGGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGC
  3  -1   2       bld Mus1      in                         CABH2798.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCCACA
  5   1   2   10  bld Ovi1 5g3  in                          CABI435.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATCGATTCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACT
  5   1   2   10  bld Lun1 5g3  in                         CABD1288.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACT
  5   1   2       bld Lun1      in                        CABD14949.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAAACGAGAACTGCACAAAAAGATCGAACTTCTCACCGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGC
  5   1   2       bld Fat1      in                         CABC4502.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTT
  3  -1   2       bld Fat1      in                         CABC6242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATCCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGGCCAGCCTGACGGGCATTGACTGCCCGGTACCCGCCCC
  3  -1   2       bld Hrt1      in                         CAAQ7632.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCA
  3  -1   2       bld Lun1      in                         CABD3783.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCGCAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGNCACCAGCA
  3  -1   2       bld Mus1      in                        CABH10618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGAGGCAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCAC
  5   1   2   10  bld Spl1 5g3  in                        CABK10204.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCC
  5   1   2   10  bld Fat1 5g3  in                         CABC1786.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCCACG
  5   1   2   10  bld Hrt1 5g3  in                        CAAQ10375.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCC
  5   1   2   10  bld Fat1 5g3  in                          CABC835.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCGTGCCGAATTCGGCACGAGGGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTG
  5   1   2       bld Lun1      in                        CABD14358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCT
  5   1   2   10  bld Ovi1 5g3  in                         CABI2104.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCC
  3  -1   2       bld Hrt1      in                         CAAQ7087.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGGCACCAGCACCTTCCTGCCCAGCCT
  5   1   2   10  bld Fat1 5g3  in                         CABC5367.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGT
  5   1   2       bld Lun1      in                        CABD13475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTC
  5   1   2       bld Lun1      in                         CABD6177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTTCTGCCCAGCCTGAC
  5   1   2       bld Lun1      in                         CABD6709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCA
  5   1   2       bld Lun1      in                         CABD8683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGGT
  5   1   2   10  bld Fat1 5g3  in                         CABC7285.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTG
  5   1   2   10  bld Fat1 5g3  in                         CABC7924.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTTCTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGAC
  5   1   2   10  bld Fat1 5g3  in                        CABC11152.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCTCCCCACCGCCACCAGCACCTTC
  5   1   2   10  bld Lun1 5g3  in                         CABD7013.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTC
  5   1   2   10  bld Spl1 5g3  in                         CABK8687.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGTCACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCCACGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTG
  5   1   2   10  bld Fat1 5g3  in                         CABC5442.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAATTCGGCACGAGGCTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCA
  5   1   2       bld Lun1      in                        CABD12703.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACT
  5   1   2   10  bld Lun1 5g3  in                         CABD7071.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCC
  5   1   2   10  bld Fat1 5g3  in                         CABC1772.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGGCACGAGGCTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCA
  5   1   2   10  bld Fat1 5g3  in                          CABC389.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCA
  5   1   2       bld Lun1      in                        CABD10232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCCGTAACCCGCCCC
  5   1   2   10  bld Lun1 5g3  in                         CABD4322.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGT
  5   1   2   10  bld Ovi1 5g3  in                        CABI13957.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGT
  3  -1   2       bld Lun1      in                        CABD11224.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGCGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTA
  5   1   2   10  bld Hrt1 5g3  in                        CAAQ10989.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTTCTGCCCAGCCTGACGGGCATTGACTGC
  5   1   2   10  bld Hrt1 5g3  in                        CAAQ11778.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCG
  5   1   2   10  bld Fat1 5g3  in                         CABC1538.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCA
  5   1   2   10  bld Fat1 5g3  in                         CABC5975.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTG
  5   1   2   30  bld Lun1 5g                              CABD5950.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTTCAACAGCTGCCCCCCACCGCCACCAGCACCTTTCTGCCCAGCCTGACGGGCATTGACTGCCCGGTACCCGCCCCCAGCCCAGGACTTTATAACCTCCT
  5   1   2       bld Lun1      in                         CABD7384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAGCCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACGCCACCAGC
  5   1   2       bld Ovi1      in                         CABI1352.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGATTCGCTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAGCCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCA
  5   1   2   30  bld Fat1 5g                             CABC10998.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGGACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGT
  5   1   2   10  bld Fat1 5g3  in                        CABC11004.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTT
  5   1   2   10  bld Fat1 5g3  in                        CABC10566.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAA
  5   1   2   10  bld Lun1 5g3  in                         CABD1570.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTCACATGAGCTCGGTGCCGATGAGCCTGGAGGCGCGCTGTCTGTCCCCCTATGCAGCCTGGTACATGGAACCCACCAACTTCTACGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAANAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGC
  5   1   2       bld In60                            IMAGE:8950006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATATATGATTAACAGCAGATAAACACGATAACGAATTCGTCCCGCCTGGTACATGGAACCCACCAACTTCTATGAGCAACGGCTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATTGCAGCAGAAGCTGCTCGAACTCTCTTCGGAGAACGAGAAACTGCACAAAAGATTCGAACTTCTCACCAGGGACTTGAAGCAGCCTCTGCACTTTCTTCAACGGCTGCCCCCCACGCCAACAGCACCTTTCTTGCCCAGACCTGGACGGGCATTGACTGGCCGGT
  5   1   2       bld Hrt1      in                        CAAQ12092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGAGGCAACGGCTGGGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGGCTCGGTACAGCCGCTACAGGGAGATGGGGATC
  5   1   2       bld In60                            IMAGE:8951720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTTTGAGCGGCTCCCCTGCCCCATGCAAGCCGAGAGCCATGTGCGAGGAGCCCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAACAGCTGCCCCCCACGCCACAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCGGTACCCGCCCCAGCCCAGACTTTATAACCTCTATACTCATCAGACTGGCCTCCTGCGCCTCAGCTCGATTCGTACAGTCGCTACGGGAATGGGAATCAGCTGAGACTGGAAGGGCTGTCCTGTG
  5   1   2       bld Te5       in                         CAAO9560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGCTGTGGGCAGTGGGGGCACCCTGGCAGAGCTAAGCGCTGCCCCTGCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGTCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCT
  5   1   2       bld In62                            IMAGE:8955736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTGAGGGATCCTATAATTTTAAAAATTCGTCCCCATCTATGACGATGAGAGCGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGACCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCACTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCACATCTCCCACAGCAGAGGGGCCTCACACCACTAGACCTGCCTGGCCCTCTAACGACTGAACAGACTTATCCATCTTTAAATATATATGTATAAAAATTAAGGGCCATA
  5   1   2       bld Neu       in                   TNeu132c06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACGATGAGAGCGCATAGACTTACTCGTACATAGACTGCTGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCACAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGGACCTCCCTGCCCTGGCACAGGTGGGGGAGGGGATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCGAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCTCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCGCAAAAAGATCGAACTTCTCACCAGGGAGTTGAGCAGCCTC
  5   1   2       bld Ovi1                                 CABI3842.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCAATAGACTTCAGCTCGTACATAGACTCCATGGCCTCCGTGCCCAACCTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGC
  5   1   2       bld Ski1      in                         CABJ1950.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGAGCTGTGCAACGACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTTGCA
  5   1   2       bld Neu                            TNeu051m01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGAGCTGTTCGCGGACCTGTTCAACTCCAGCAAAGCGGTGGGAGAGCGGCAGGAGTGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTT
  5   1   2       bld In63                            IMAGE:8958801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCGGCGGGGGTGACTACCTGAGCGGGCTCTTGGCGGCACCTCCCTGCCCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGTCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATAATATATGTATAATATTTAGTGCATAAGACATTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGAAATGGGGAGAGATCGGCATCATCTCAGCGTTCAATGGCCGAGCTCGGTCCAGCTGCATCTGCCAATGCAAGGGTTAAACTAGGAGATATATGGCCTCCAT
  5   1   2       bld Fat1      in                         CABC4287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGGCACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCAT
  5   1   2       bld Ski1      in                         CABJ7925.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACAGCTGGCAAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTGCCCACTGTGTGCATG
  3  -1   2       bld Liv1      in                        CAAR11824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGGGCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCT
  5   1   2       bld Hrt1      in                          CAAQ658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATCTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGG
  5   1   2       bld Lun1      in                         CABD6741.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCAAGCAAGAGCCGGAGTGGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAAC
  5   1   2       bld Ski1      in                         CABJ3597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGCGACAGCGACTTGTCCTCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGGTGCCCAGCGCTAGTTACACCTTCTA
  5   1   2       bld Fat1      in                         CABC1951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCATCGATTCGCTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGANATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCANGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATT
  3  -1   2       bld Ski1      in                         CABJ6868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTCGCTGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCA
  5   1   2       bld Brn3      in                        CAAK12304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCCAACCAAATCGCAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCTTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCA
  5   1   2       bld Int1      in                        CAAP13663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCCTGTGCCCAGACCAGCATGAGCCTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGANATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGNGCCCATTTNCTGCCCACTGTGTGCATG
  3  -1   2       bld Mus1      in                         CABH7868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGCAGCCCACCCCTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAAT
  5   1   2       bld Ovi1      out                        CABI8493.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGGTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTTCTGAGCACAGCTCTCATTGCCCTGCTGGT
  5   1   2       bld Ski1      in                         CABJ6616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCCACCTCCCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCAT
  3  -1   2       bld Int1      in                        CAAP10828.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAGGCCGGAGCCCAGCACCTCAGCCTGCCCTTCCCCGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAGGTGTTGA
  5   1   2       bld Limb      in                        CBSU8156.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGAGCCCAGCACTCTCAGCCTGGCCCTTCCCCGGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGTCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCA
  5   1   2       bld Lun1      in                        CABD10253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCACCTCAGCCTGCCCTTCCCCGGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGNGTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATC
  5   1   2       bld Ovi1      in                        CABI13555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATCGATTCGCCCCNGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCA
  5   1   2       bld Int1      in                        CAAP14434.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCCTTCCCCNGGCTTCCCCCAGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGGTGT
  5   1   2       bld In63                            IMAGE:8961363.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTTTTTTGTCAGTTCCTTCATTTAAATAATTCGTCCCGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCTTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGCCATGGCAGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAGTGTGATACGAATGGGCAAGCTGTGCCTCTGCTTCTGAGCACAGCTCTCATGCCTGCTGTGCATGTGGTGTGTAGTCAGCAGCAGACGCTATCAAGATAGATGTTCACTGCTGCATCAGTCACCGGATAGGTACCGACTTGGCACTGCCATGCCATTAGAATCATTCTAGGTGGAGTTAGCTGTCTCCTGGCCTGCATGCAAGTGAACAATAAC
  5   1   2       bld In60                            IMAGE:8950328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTCCTGCGGCAAAGACAGGACGGGCAAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCTTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCTTTCACCTGCCAGTGCCTGGTGCCCAGCGCTAGTTACACCTTCTATTTGCATCCAGGTGTTGAAATAAGAATGGCAAGCTGTGGCTCTGCTCTGAGCAACAGCTCTCATGCCTGCTTGTGCATTGTGGTGTTTGTAGTTCAGACGCCCAGAAACAGCCCTATCCAG
  5   1   2       bld Spl1      in                         CABK7867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAAGCTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGA
  5   1   2       bld In62                            IMAGE:8957002.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACGCTTGTTAGATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCTTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGCCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCTTTCACCTGCCAGTGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTATTTGCATCAAAGTGTTGAATAGATGGGCAGCTTGTGGCCTCTGCCTCTGACACACGCTCTCATGGCTGCTGTGCATGGTGGGTTGATTCACCAGCAAACGCTATCAAGAATATAGAGTGTTCAAACTGGGCCTGAA
  5   1   2       bld Liv1      in                         CAAR4961.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATCGATTCGCTCAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGATTAT
  5   1   2       bld Lun1      in                        CABD10328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCGCTACAGCCCCGAGTACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATG
  5   1   2       bld Int1      in                        CAAP13778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGATTATG
  3  -1   2       bld Ski1      in                         CABJ4055.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGCAGCGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGT
  5   1   2       bld Neu                            TNeu010f02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCGCAGGGNAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGC
  5   1   2       bld Ovi1      in                        CABI14433.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCAGGGAGCGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGNGTGTTGTAGTTCAGCAGCCAGACAGCTATCANAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGG
  5   1   2       bld Liv1      in                         CAAR8445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCAACAATATCGCCGTGAGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGGCCTCTGCCTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAATTC
  5   1   2       bld Ski1      in                        CABJ11914.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGNGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGT
  5   1   2       bld Int1      in                        CAAP13737.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGAGCCGCGACAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTAT
  3  -1   2       bld Spl1      in                         CABK5229.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATATATAATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGNGTGTTGTAGTTCAGCAGCCAGACAGCTATCANAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCAGCTGCCCATGTGCCCACATAGTAATCATTCT
  5   1   2       bld Ski1      in                         CABJ2243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCCAAAAAGCGCAACATAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTACAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGNGTGTTGTAGTTCAGCAGCCAGACAGCTATCNAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGG
  5   1   2       bld Spl1      in                         CABK4217.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCGATTCGTAGACATGCAGCAGAAGCTGCTCGAACTCTCCTCGGAGAACGAGAAACTGCACAAAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAG
  5   1   2       bld Ovi1      in                        CABI13264.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAGATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCANAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACA
  5   1   2       bld Egg                            TEgg112o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGTCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATC
  5   1   2       bld Egg                            TEgg112o02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCGAACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCAGCTCCGGTACAGTCGCTACAAGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACGCCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAAGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCCGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATATCTTGCCCACTGTGTGCATGATAGTGCAACTGCTC
  5   1   2       bld Ski1      in                         CABJ1792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTTCTCACCAGGGACTTGAGCAGCCTCCGGCACTTCTTCAAACAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCANAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTNTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATAC
  5   1   2       bld Int1      in                         CAAP7790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACGAGGAGGAGCTCCGGCACTTCTTCAAAAGCTGCCCCCCACCGCCACCAGCACCTTCCTGCCGAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCANAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGC
  5   1   2       bld In62                            IMAGE:8956432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTAATTTTATAATATCTTCTTTTTAAACTTAATCGTCCGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGTCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAGGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCAGGGATAAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCTGTCTCACTGTGCTTGCATGCCAAGCTGCAGCATACACCCTTACTGCTTATCATTCTCTGCCTTAGAGTACGCTAACTCAAAGTACAAAGGCTGCTGAGTTGAGCTTTATTTCAGCATAGCCAATAGACCCCTATGAGCTGAAGCCAT
  5   1   2       bld Tail                                 CBSW9810.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCGCCAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGA
  5   1   2       bld Liv1      out                        CAAR6482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCACCTTCCTGCCCAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCANAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTNGTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTAATTCATCTCTGCCTTA
  5   1   2       bld Int1      in                         CAAP8480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCCTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCANAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACT
  3  -1   2       bld Hrt1      in                        CAAQ12723.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGACGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGGCTATTCATCTCTGCCTTANGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATA
  5   1   2       bld Ovi1      in                         CABI7208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGCATTGACTGCCGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCA
  5   1   2       bld In63                            IMAGE:8961803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAAGTATATCCAATATCGGATAAACCTCTATCGTATTCGTCCCCCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGTCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCTTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAAGGTACCGAGCTTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTTGCCTTGCATGCCAGGCTGCAGCCATACACCCTTTACTGCTTATTCATCTTCTGCCTTAGAGTAAGGCTAACTCAAGTACAAAAGCTTGCCGAGTTTAAAAGCTATTCACATGCCATTAGACCTAATGAGTTTGAAGCAGTATGCCAAAGTCTAAAACCTGCCATGGGTGATGACCTTCAGCCCACCGC
  5   1   2       bld Liv1      in                         CAAR7125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGTAACCCGCCCCCAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCCTAGGAGTAAGGGCTAACTCAAAGGTACA
  5   1   2       bld In62                            IMAGE:8954880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCCCCCAAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGTCGCTACAGGGAGATTGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGCTTGCATCAGTCACCAGGATAAGGTACCGAGCTTGTGCAGCTGCCATGTGCCACATTAGTATCATTCTATAGTGTGATGTATGCTGTCTCACTGTGCTGGCATGCAAGCTGCAGCCATACACCCTTTACTGGCTTATTTCATCTCTGCCTTTAGA
  5   1   2       bld In62                            IMAGE:8954885.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACCCCAAGCCCAGGAACTTTTATTAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGTCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCAGGGATAAGGGTACCGAGCTTTGGTTGCCAGCTGCCCATGTGCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTTGCTTATTCAT
  3  -1   2       bld Int1      in                        CAAP12483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCCCAGGACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCANAGGTACAAAAGCTGCAG
  5   1   2       bld Hrt1      in                        CAAQ11488.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTA
  5   1   2       bld Ski1      in                          CABJ549.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACTTTATAACCTCCTATACCTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCANAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATA
  5   1   2       bld Liv1      in                         CAAR6922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCATTCCAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGC
  5   1   2       bld Ski1      in                         CABJ5198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGACATGGCCCTCCTGCGGCCCTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCANAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCANAAAGTCTAAAAGCTGCCAGTGTGT
  5   1   2       bld Int1      in                        CAAP11367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCAGCCTCGGCTCCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCANAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGA
  3  -1   2       bld Liv1      in                         CAAR4600.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGCGAGAGGTCGGTACAGCCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTG
  5   1   2       bld Hrt1      in                         CAAQ3658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGCTACAGGGAGATGGGGATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTG
  5   1   2       bld TpA       out                  TTpA031p08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCAGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTANGAGTAAGGGCTAACTCANAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTC
  5   1   2       bld In60                            IMAGE:8949367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCAGCTGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCAGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGAGTAAGGCTACTCAAAGGTACAAAGCTGCAGAGTTTAGAGCTATTTCAGCATAGCAATAGACCCTAGTGAGTTGAGCAGTATGCAAAGTTCTAAAAGCTGCCAGTGTTGTAGTACCTTCAGCCACGCTGAACTTCCACCTCTCCAAGGTT
  5   1   2       bld Liv1      in                         CAAR8472.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAGCTGGAGGGCTGCCTGTGAGACTTTGCTGCAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCANAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTC
  5   1   2       bld In62                            IMAGE:8953049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCGCTGATAAATATGATCCAAACAAATTCAAATTCGTCCCGCAAGAGGGGGCCTCACACCACCTGGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCAGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTTGCATGCCAAGCTGCAACCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGTCTAACT
  5   1   2       bld Sto1      in                        CABG12139.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAACATCTCCCACAGCAAGAGGGGGCCTCACACCACCTAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCCAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCA
  5   1   2       bld Liv1      in                         CAAR6778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGAGGAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACT
  5   1   2       bld In54                            IMAGE:8943137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCCCGCCACGCCACCGGAGCCGCCCGCCCCGAATTCGTCCCGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCCATAAGACACTAGTGAGTTGAAGCATTAGTGCAAAAGTCTAAAGCTGCCAGTGTGTAGTACTTCACCACGCTGAACTGCAACTCCAAATGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAAATAACTCGTCAAAACCCGGTGCCCGTTATCAGCTGAAATGAT
  5   1   2       bld Liv1      in                         CAAR2691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACT
  5   1   2       bld Ski1      in                        CABJ11533.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGACACTTGCCCTGCCCCCTCTTACAGACTGAGCCAAAGACTTATCACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGGGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGGACTACAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTACATGCTGGTACCTGTCTCGNTCATTGCATTGCTTGACT
  5   1   2       bld Neu                            TNeu020l04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACATCTTTAATATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTG
  5   1   2       bld Lun1      in                         CABD8659.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATTCGAATTGGACGAGGATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTT
  5   1   2       bld TpA       in                   TTpA051l03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATATATGTATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAANAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAAACTGCACTCCCAAAGTGCTTGTGCAATGGCTG
  5   1   2       bld Te4       in                         CAAN1170.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGATTCCCGGGATTCGTCGACCCCGCGTCCGGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCAGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCCTACAGTACCCAACAGGATATCTA
  5   1   2       bld Hrt1      in                         CAAQ6625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAATATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCC
  5   1   2       bld Sto1      in                         CABG5727.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTAGTGCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCT
  3  -1   2       bld Spl1      in                         CABK5203.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGT
  5   1   2       bld Limb      in                        CBSU9195.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAATAAGACATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCAGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACNAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTG
  5   1   2       bld Brn4      in                        CAAL10538.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCAGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTATCAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTTGCTGACTAGGTGTCTTTAGCCCCCT
  5   1   2       bld Sto1      in                         CABG5610.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTGCAAGGTATTACCAGTGGGTAGTGCCCTGCAGGAAATGGGAGAGAATCGGGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGC
  5   1   2       bld Limb      in                         CBSU613.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCATCATCTCAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGTGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCT
  5   1   2       bld Sto1      in                         CABG6531.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAACCCTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAAGATATCTACTGT
  5   1   2       bld Liv1      in                         CAAR6640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTCAGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTANGTGTCTTTAGCCCCCTGGCCTTACAGTAGCCACAGGATATCTACTGT
  3  -1   2       bld Liv1      in                         CAAR9379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGCCAGAGCTCGTTCAAGCTGCATCTTGGCCATGGCAGGTGTAACTAGGAGTATTGCTCCATAGGCATTGGGCCCATTTCTTGCCCACTGTGGGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGATGGGCTGTTCTGAATCTGATTTGCGGAAGTACTGTATGA
  5   1   2       bld Tad5      in                         XZT39597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCATGATAGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGGCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCNNCACAGA
  5   1   2       bld Brn4      in                        CAAL23726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGTGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTTCTAGTACCAAGGGCAGCT
  5   1   2       bld Bone      in                        CBTC3763.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAACTGCTCCCCTTTCACCTGCCAGTGGCCTGGGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCNTGGTACCTGTCTCGTTCATTGCCATTTGCTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAAAAGCATTGAT
  5   1   2       bld Liv1      in                         CAAR2408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTTGCCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATTAAT
  5   1   2       bld Liv1                                 CAAR6591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCCAGGGCAGCT
  5   1   2       bld Tail      in                         CBSW3388.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCGCTAGTTACACCTTCTAATTTGGCATCCAAGGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGA
  5   1   2       bld Neu                            TNeu024j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGGATTCCCCGGGTAATTTGGCATCCAAGTGTTGAATAAGGAATGGGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTNTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGT
  3  -1   2       bld Ovi1      in                         CABI1408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTATAGGGCGAGAGGGAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCC
  5   1   2       bld Spl2      in                        CBSS2892.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAAGCTGTGGCCCTCTGCCTTCTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGNGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAANGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTGTTCTAGTT
  3  -1   2       bld Liv1      in                         CAAR2811.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAGCAACAGCTCTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATT
  3  -1   2       bld Lun1      in                         CABD7594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCATTGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCC
  5   1   2       bld Ski1      in                         CABJ9655.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCGATTCAATCGGCACGAGGGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAANACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCC
  3  -1   2       bld Kid1      in                         CABA6759.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCCTGCTGGTGCATGGTGGGTGTTGTAGTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTNTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATT
  5  -1   2       bld Fat1      in                         CABC6242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATGTGGGGTGTGTAGTTTCAGCAGCCAGACAGCTATCAAAGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAA
  3   1   2       bld Lun1      in                         CABD7384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGTGGGTGTGTTAGTTCAGCAGCCAGACAGCTATCAAAGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCACCTCTCGCCCTAT
  5  -1   2       bld Lun1      in                        CABD11224.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTTGTAGTTCAGCAGCCAGACAGCTATCAAGGGATTATGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTT
  3   1   2       bld Neu0 5g3  in                       IMAGE:6992780                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCAGGACAGTTTTCAAAGGATTTAGAAGGGTTTCACAACGGGGGCTTGCATCAGTCACCCCGGGTAAAGGGTACCGAGCTTTGGTGCCAGCTGCCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACCCAAGCCTTTGTATTGTNAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTACAG
  3   1   2       bld Hrt1      in                         CAAQ6625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCTATCAAGGATTTATGAAGTGTTCACAACTGGGCTGCANTCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATG
  5  -1   2       bld Lun1      in                         CABD3783.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAGTGTTCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAG
  5   1   2       bld Sto1      in                        CABG10685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATTCGGCACGAGGTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACTATAGAATGATTACTAATGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTT
  3   1   2       bld Ski1      in                         CABJ1792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTCACAACTGGGCTTGCATCAGTCACCGGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAGTAAAAAAA
  3   1   2       bld Lun1      in                         CABD8659.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGA
  3   1   2       bld Ovi1      in                        CABI13264.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCACAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATG
  5  -1   2       bld Int1      in                        CAAP10828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCA
  3   1   2       bld Ski1      in                        CABJ11914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACTGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  5  -1   2       bld Spl1      in                         CABK5203.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAACTGGGCTGCATCAGTCACCCGGGATAGGGTACCGAGCTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATG
  3   1   2       bld Fat1 5g3  in                        CABC10566.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Hrt1      in                         CAAQ3658.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAAA
  3   1   2       bld Fat1 5g3  in                        CABC11004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTTGCATCAGTCACCCCGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATAGTAAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2      seed Ovi1 5g3  in                        CABI13957.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAA
  3   1   2       bld Lun1      in                         CABD6741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGGCTGCATCAGTCACCCGGATAAGGTACCGAGCTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAGCCTCTCGCC
  3   1   2       bld Spl1 5g3  in                        CABK10204.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAGTT
  3   1   2       bld Int1      in                        CAAP14434.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTGCATCAGTCACCCCGGATAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGCCGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTACCTCTCG
  3   1   2       bld Sto1      in                        CABG12139.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTTGCATCAGTCACCCGGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAG
  5   1   2       bld Sto1      in                         CABG2168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACA
  3   1   2       bld Int1      in                        CAAP13663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTT
  3   1   2       bld Fat1 5g3  in                         CABC5442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAGTTAAAAAAA
  3   1   2       bld Ski1      in                        CABJ11533.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGCATCAGTCACCCGGGATAAGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGGGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Neu       ?                     TNeu075a21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATCAGTCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAGTTAAAAAAAAAAAAAAAAA
  5  -1   2       bld Hrt1      in                         CAAQ7632.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATCAGTCCCCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAG
  3   1   2       bld Ski1      in                         CABJ3597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATCAGTCACCCGGGATAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAG
  5  -1   2       bld Mus1      in                        CABH10618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCACCCGGGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTACCTCGTGCCGAT
  5  -1   2       bld Spl1      in                         CABK5229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCACCGGGGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAA
  3   1   2       bld Liv1      in                         CAAR7125.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACCCGGGATAGGGTACCGAGCTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Brn4      in                        CAAL23726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Fat1      in                         CABC4502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAGT
  3   1   2       bld Lun1      in                         CABD6177.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAA
  3   1   2       bld Ovi1 5g3  in                          CABI435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAAA
  3   1   2       bld Ski1      in                          CABJ549.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Te4       in                         CAAN1170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAAT
  5  -1   2       bld Liv1      in                         CAAR9379.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAAT
  3   1   2       bld Fat1 5g3  in                         CABC7285.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Ski1      in                         CABJ2243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATG
  3   1   2       bld Ski1      in                         CABJ7925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Brn4      in                        CAAL10538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Int1      in                        CAAP11367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTT
  5  -1   2       bld Int1      in                        CAAP12483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATG
  3   1   2       bld Hrt1      in                        CAAQ11488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTNGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  5  -1   2       bld Kid1      in                         CABA6759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTT
  5  -1   2       bld Ski1      in                         CABJ6868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGGGGTACGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Neu       in                    TNeu132c06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      in                         CAAP8480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAGGGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTC
  3   1   2       bld Fat1      in                         CABC4287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Lun1 5g3  in                         CABD1570.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTA
  3   1   2       bld Spl1 5g3  in                         CABK8687.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAGGGTACCGAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAGAAAAAAAAAAA
  5  -1   2       bld Hrt1      in                        CAAQ12723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGTANCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAA
  3   1   2       bld Lun1 5g3  in                         CABD7013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Spl1 5g3  in                         CABK3397.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Hrt1 5g3  in                        CAAQ10989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATG
  3   1   2       bld Lun1 5g3  in                         CABD4322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATCCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAGCCTCTCGCCCT
  5  -1   2       bld Liv1      in                        CAAR11824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATGATGAATAATAAAAAAAGAA
  3   1   2       bld Lun1      in                        CABD10253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAGAG
  3   1   2       bld Hrt1 5g3  in                        CAAQ11778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGNCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Lun1      in                        CABD10232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGNCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAA
  3   1   2       bld Int1      in                        CAAP13778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTT
  3   1   2       bld Fat1 5g3  in                          CABC389.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAAT
  3   1   2       bld Te5       in                         CAAO9560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Ovi1      in                         CABI7208.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Fat1 5g3  in                        CABC11152.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACTTTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Sto1      in                         CABG2168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCTTTGGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Ski1      in                         CABJ5198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCTTTGTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAGTT
  3   1   2       bld Ski1      in                         CABJ9655.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Hrt1      in                        CAAQ12092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Fat1 5g3  in                         CABC5367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Lun1      in                        CABD13475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAACGAAACAC
  3   1   2       bld Sto1      in                         CABG5610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Ovi1      in                        CABI13555.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Ovi1      in                        CABI14433.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Lun1 5g3  in                         CABD7071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Sto1      in                        CABG10685.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAGCTGCCCATGTGCCACTATAGAATGATTACTAATGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  5  -1   2       bld Mus1      in                         CABH7868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAA
  3   1   2       bld TpA  5x3  out                   TTpA031c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Hrt1      in                         CAAQ7087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTGNCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACCCTCGTGCCGAATTG
  3   1   2       bld Liv1      in                         CAAR4961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Lun1      in                        CABD10328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Lun1      in                        CABD14358.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  5  -1   2       bld Lun1      in                         CABD7594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Lun1      in                         CABD8683.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Ski1      in                         CABJ1950.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Spl1      in                         CABK4217.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Spl1      out                        CABK5072.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Hrt1 5g3  in                        CAAQ10375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Liv1      in                         CAAR8472.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCTGCCCATGTGCCACATAGTAAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCTTAGGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Fat1 5g3  in                         CABC5975.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Int1      in                         CAAP7790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCCCATGTGCCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCNTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGCTCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  5  -1   2       bld Ski1      in                         CABJ4055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAAC
  3   1   2       bld Ski1      in                         CABJ6616.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGCCACATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGNCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  5   1   2       bld HeRe      in                      EC2CAA4CB12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    agcagtggtatcaacgcagagggcccattatggccgggGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGCGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTACCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCAACTTCCTT
  3   1   2       bld Lun1 5g3  in                         CABD1288.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACATTAGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Liv1      in                         CAAR2691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTAGTAATCATCCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCAGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld TpA       in                    TTpA051l03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATTTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1 5g3  in                         CABC1786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTGCCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCTTAGGGAGTAGGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Sto1      in                         CABG6531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Liv1      in                         CAAR6640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACACAAAAAAA
  3   1   2       bld Int1      in                        CAAP13737.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Liv1      in                         CAAR8445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTAATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  3   1   2       bld Lun1      in                        CABD12703.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTAATCATTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  5   1   2       bld Gas8      in                         st109l22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCC
  5   1   2       bld Gas8      in                         st111l22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCATTCTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCC
  3   1   2       bld Ovi1 5g3  in                         CABI2104.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTATAGTGTGGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAAACAC
  5  -1   2       bld Mus1      in                         CABH2798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCGGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGGCCCAGAAGCATTGAATGTGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAGTAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTGTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTTACAGCATTTTTATTATGAATAATAAAAAAAGAA
  5  -1   2       bld Liv1      in                         CAAR2811.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAAGGGCTAACTCAAAGGTACAAAAGCTGCAGAGTTTAGAGCTATATCAGCATAGCAATAAGACACTAGTGAGTTGAAGCAGTAGTGCAAAAAGTCTAAAAGCTGCCAGTGTGTAGTACTTCAGCCACGCTGAACTGCAACTCCCAAAGTGCTTGTGCAATGGCTGAGGGACTACAAGCTGATCAGATTACCTGTCATAAGCCTGTGCCTGTTATCAGCTGAAATGTGTGCCCTTCTGAGCTAACATGCTGGTTACCTGTCTCGTTCATTGCCATTGCTTGACTAGGTGTCTTTAGCCCCCTGGCCCTTACAGTAGCCAACAGGATATCTACTGTCCCAGAAGCATTGAATGGGCTGTTCTGAATCTGATTGCGGGAAGTACTGTATGAATAAGGGCAGTGCCAGTGTGGATCGGTGCTGGCCTGCAGTTTCTATTCTAGTTACCAAGGGCAGCTAAACATTCACAACAGATATATATATAAATGTATTTTCTCTCCACTAAAGTATAAACAAAGCTAAAACATTTCCCCTTTATCCCCCCAACTTCCTTAAATTATTTTTGTAATGTAGTTTTCTGTATTCTTACTGATGCAGCTATGGCACATTTGTATAATGATTTCCCAGAGACAAGCCTTTGTATTGTAGATAATAGGGACAGAGAAATGAGCATGCTCAACTTTTTATATGATCATTTTT
  3   1   2       bld Spl1      in                         CABK7867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAGTGTTGGATGTATGCCTGTCTCACTGTGCCTTGCATGCCAAGCTGCAGCCATACACCCTTACTGCTTATTCATCTCTGCCTTAGGAGTAA