Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 75%

 1012070306 Xt7.1-CABD13559.3 - 174 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           3     6     3     6     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     6     2     7     4    10     6    15    17    30    43    50    64    64    71    72    73    73    73    73    74    74    74    74    75    75    75    75    75    75    75    75    75    75    76    76    76    76    76    76    77    77    78    78    78    78    78    78    78    78    78    79    79    79    79    79    80    80    80    80    81    81    82    83    84    85    87    88    89    90   102   108   103   108   103   108   111   117   113   120   113   124   139   143   142   146   141   147   147   152   146   153   145   152   147   152   149   154   149   154   149   154   150   155   151   157   153   158   154   159   157   161   156   161   157   162   156   161   156   161   155   161   155   160   155   160   155   160   154   160   154   160   154   160   153   159   153   159   153   159   150   158   147   157   139   157   135   152   138   148   130   138   115   119   107   111    92    97    93    96    91    95    93    94    93    94    93    94    93    94    93    94    93    94    93    94    93    94    94    98    95    98    94    98    94    97    94    97    92    95    94    95    93    95    93    95    93    95    93    95    91    95    91    92    88    91    86    88    84    86    79    84    59    65     8     8
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGTCTTCTTTCCCAGAGTTTGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------A---
                                               BLH MIN     138      89                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR     255      37                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               EST CLI     178      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG     255       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 7e-014     XP_421596.2 PREDICTED: similar to prosaposin [Gallus gallus] -------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dm ==== 2e-020     NP_524597.1 Saposin-related CG12070-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 5e-024     XP_001199609.1 PREDICTED: similar to prosaposin, partial [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xt ==== 3e-028     CAJ83778.1 Novel protein similar to prosaposin [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dr ---- 4e-031     NP_571958.1 prosaposin [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 3e-058     NP_000533.2 surfactant, pulmonary-associated protein B; Pulmonary surfactant-associatedprotein B, 18kD [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---= 2e-059     NP_680088.1 surfactant associated protein B [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAI23316.1 MGC154673 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = ?? ==== 0          NP_001090386.1 hypothetical protein LOC779297 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABD13559.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------ATG---TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       bld Egg  5g3  in                   TEgg021j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATGGTCATCAGTCATTGCTGGGACACAGGACCCTTTGAGTCTTCTTTCCCAGAGTTTGGGATGTAGGTAATTAACCAACCGACCTAAAACATGGACTCCTGAGCATCCAGTCCAATACGTATGTGGCTACAAGCCCTATTTGCTTTGTAATTTCCCTTCGATATCTGTTCCCTCTGCACCTATTGCTCAGTACTACTGATATAAATGTAAGAAGCCACATAGCAGACTCCAGCAGCGGGTTGGGTTACCTGCATAGAAAGCGGGTACCCTGCAGGTTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCT
  5   1   2       chi Egg                            TEgg107i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGCCTGCATAGAAAGCGGGTACCCTGCAGGTTGCAGTTTCTGAATTCTTCGCACATGCAAAGCAGGATAGATTCGCTCATCACATGAGTTTCTGGAAGTCTGAGTGTTGTAATGGCACCTTCCCTTCTGTTTGCAGAGGAGCCGACACTTCACACAGCACCTTTAAGTTGTGCCAACATTTTTGTTTCACTGAAATGCACAAACCCCCACCTAAAATGCATGCTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTG
  5   1   2       bld Egg  5g                        TEgg104a11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTAATTAACCAACCGACCTAAAAATGGACTCCTGAGCATCCAGTCCAATACGTATGTGGCTACAAGCCCTATTTGCTTTGTAATTTCCCTTCGATATCTGTTCCCTCTGCACCTATTGCTCAGTACTACTGATATAAATGTAAGAAGCCACATAGCAGACTCCAGCAGCGGGTTGGGTTACCTGCATAGAAAGCGGGTACCCTGCAGGTTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAAT
  5   1   2       bld Egg  5g                        TEgg032p11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAGGTCAGATGGTCATCAGTCATTGCTGGGACACAAGGACCCTTTGAGTCTTCTTTCCCAGAGTTTGGGATGTAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTG
  5   1   2       bld Gas0 5g                              dad33h03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGNTCAGTCATTGCTTGGACACAAGNACCCTTTGAGTCTTCTTTCCCAGAGTTTGGGATGTAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTTGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAA
  3  -1   2       bld Lun1      in                        CABD12773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAGATGGAAGGAACACGCCTGGTCTGGCTCCTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAAGTAGAGGC
  5   1   2       bld AbdN 5g                            IMAGE:7003641                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAGATGGAAGGAAACGCCTGGTCTGGCTCCTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAAGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTTCATGTGTTGCCCACAGATGAAAAACCTGTGAGGCCAAGTTTTAACAGTTGAATACCCAGTTTCTTGGGATGCTTGAATTTTTACCCCGGTGGAACACCTGGG
  5   1   2       bld Lun1      in                        CABD14829.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCAATTCGGCACGAGGTCTGGCTCCTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNNCATCAACCCACCATAAGGCAGAACATGACCCANGCAGAGGT
  5   1   2       bld Lun1      in                        CABD12926.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGATTCAATCGGCCGAGGCTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGGTAACGCAAGCATTATATCTTCTGCTACCATTCCACTCTGTGTCTGGGGCACAATAGGGCCCTGAGTTCTGTACCAATACAGTCACCCCCCCCCCATGTATTTTGATTTGCTAAGCAGCGGTCACAAGCACCGTGTATAAATATATATAAATAGCACTACTAGCATGGATGTTGTACATTTATACAGTGTAGAAAAGTACGCTCAGGATGGACAAGCATTATAATTAATACTGTAAGATATAGATATATACAAGGATTAAATGCCATGGGGTAAGAGACACTAGAAATGAAGTTCCTGCCCTGTAGAGCTTACATTCTAATTCCCTA
  5   1   2       bld Lun1      in                        CABD10404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAATTCGGCACGAGGTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAANGCAGAACATGACCCANGCAGAGGT
  5   1   2   10  bld Fat1 5g3  in                        CABC11067.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGTCTGGCTCCTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGC
  5   1   2   10  bld Fat1 5g3  in                         CABC1746.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAATTCGGCACGAGGCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNNCATCA
  5   1   2       bld Lun1      in                         CABD7422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGTCTTCTTTCCCAGAGTTTGGGATGTAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGTAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGNCGTTACCTCTGNCATCAAACCCACCAT
  3  -1   2       bld Lun1      in                        CABD12808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCTATAGGGCGAGAGGCTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCANGC
  5   1   2   10  bld Ova1 5g3  in                        CABE13193.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAGTCTTCTTTCCCGAGTTTGGGATGTAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACTGTGACACGTGCCTGGCCGTTACCTCTGCAATC
  5   1   2       bld Lun1      in                        CABD12577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTCCTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACTTCTGCAATCCAACCCACCATAAGGCAGAACATGACCCAGGCAGAAGTAGAGGC
  5   1   2       bld Lun1      in                        CABD12595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCCATCGATTCGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAANGCAGAACATGACCCANGCAGAGGTAGAGGCCGC
  3  -1   2       bld Fat1      in                         CABC7291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAGGGCGAGAGGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNNCATCAACCCACCATAAGGCAGAACATGA
  5   1   2   10  bld Fat1 5g3  in                         CABC1641.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGGCCGTACCTCTGNCATCAAACCCAACATAAG
  3  -1   2       bld Fat1      in                         CABC7031.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGGGCGAGAGGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCANACCCACCATAAGGCAGAACATGACCCAGGCAGAGGT
  3  -1   2       bld Fat1      in                         CABC4555.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGGTAACGCAAGCATTATATCTTCTGCTACCATTCCACTCTGTGTCTGGGGCACAATAGGGCCCTGAGTTCTGTACCAATACAGTCACCCCCCCCCATGTATTTTGATTTGCTAAGCAGCGGTCACAAGCACCATGTATAAATATATATAAATAGCACTACTAGCATGGATGTTGTACATTTATACAGCGTAGAAAAGTACGCTCAGGATGGACAAGCATTATAATTAATACTGTAAGATATAGATATATACAAGGATTAATTGCCATGGGGTAAGAGACACTAGAAATGAAGTTCCTGCCCTGTAGAGCTTACATTCTAATTCCCTAAACTTTTTGACATTACTCTCTCTTGGGGAGCTAATTATAAGAAGTAGCACAAGTACCGGATATCATTACTTTTTTACATTTTAAC
  5   1   2   10  bld Fat1 5g3  in                         CABC6271.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAAGTAGAGGCC
  5   1   2       bld Lun1      in                        CABD12422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCAC
  5   1   2       bld Lun1      in                        CABD12524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACC
  5   1   2       bld Lun1      in                         CABD9917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATCGATTCGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCA
  5   1   2   10  bld Fat1 5g3  in                         CABC8445.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGT
  3  -1   2       bld Lun1      in                         CABD9653.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGAGAGGCTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACCGAGAGCCTGGCATGGCA
  5   1   2       bld Lun1      in                        CABD12800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCAT
  5   1   2       bld Fat1      in                         CABC1977.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATTCAATTCGGCACGAGGCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAAGCAGAACATGACCCANGCAGAAGTAGAGGCCGC
  3  -1   2       bld Fat1      in                         CABC5077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGAGAGGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAACCCCA
  3  -1   2       bld Fat1      in                         CABC6704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCC
  5   1   2   10  bld Fat1 5g3  in                         CABC7630.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAAGT
  5   1   2   20  bld Fat1 5g                              CABC8230.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCA
  5   1   2       bld Fat1      in                         CABC9348.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNNCATCAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCC
  5   1   2       bld Lun1      in                        CABD13993.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGAGTGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCC
  5   1   2       bld Fat1      in                         CABC6736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCA
  5   1   2       bld Lun1      in                        CABD12545.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCCTGGCCGTTACCTCTGCCATCAAACCCACCATAAGGCAGAACATGACCCA
  5   1   2   10  bld Fat1 5g3  in                         CABC7752.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGT
  5   1   2   10  bld Fat1 5g3  in                         CABC7874.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCCACATAANGCAGAACATGACCCANGCAGAGGTAGAGGCC
  5   1   2       bld Lun1      in                        CABD10597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATG
  5   1   2       bld Lun1      in                        CABD13010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGA
  5   1   2       bld Lun1      in                        CABD13931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAAGTAGAGGCCGCAGTTCTGAAAGCCCA
  5   1   2   10  bld Fat1 5g3  in                        CABC10506.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCCACATAAGGCAGAACATGACCCANGCAGAGGT
  3  -1   2       bld Fat1      in                         CABC1677.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNNCATCAACCCACCATAAAGCAGAACATGACCCA
  5   1   2   10  bld Fat1 5g3  in                         CABC8215.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCA
  3  -1   2       bld Int1      in                         CAAP1894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGGGCGAGAGGCCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGC
  5   1   2   20  bld Fat1 5g                              CABC4886.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGC
  5   1   2   20  bld Fat1 5g                               CABC710.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATCGATTCGGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAAGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAA
  5   1   2       bld Fat1      in                         CABC2160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCAC
  5   1   2       bld Lun1      in                         CABD9949.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCAATCAACCCACCATAAGGCAGAACATGACCCAAGCAGAAGTAGAGGCCGCAGTTCTGAAAGCCCAC
  5   1   2       bld Fat1      in                         CABC2037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAAGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCA
  5   1   2   10  bld Fat1 5g3  in                         CABC4690.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCANATCAACCCACCATAAGGCAGAACATGACCCAGGCAGAAGT
  5   1   2   10  bld Fat1 5g3  in                         CABC5954.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCNATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGT
  5   1   2   10  bld Fat1 5g3  in                          CABC864.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCT
  5   1   2   10  bld Fat1 5g3  in                         CABC1540.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGG
  5   1   2       bld Lun1      in                        CABD11947.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCC
  5   1   2       bld Lun1      in                        CABD13344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGG
  5   1   2   10  bld Fat1 5g3  in                        CABC10772.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGC
  5   1   2   10  bld Fat1 5g3  in                         CABC5092.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCA
  5   1   2   10  bld Fat1 5g3  in                         CABC7015.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCAC
  5   1   2       bld Lun1      in                        CABD10308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGA
  3  -1   2       bld Fat1      in                         CABC1965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGA
  5   1   2   10  bld Fat1 5g3  in                         CABC1387.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCCACG
  3  -1   2       bld Lun1      in                        CABD12022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGA
  5   1   2   10  bld Fat1 5g3  in                        CABC11429.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAAGTAG
  5   1   2       bld Fat1      in                         CABC2107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCAAGCAGAAGT
  5   1   2   10  bld Fat1 5g3  in                         CABC5861.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGNCATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGT
  5   1   2       bld Lun1      in                        CABD13559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGGTCCCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCT
  5   1   2   10  bld Fat1 5g3  in                         CABC8091.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGTAAAGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAAGT
  5   1   2       bld Lun1                                CABD12583.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATCGATTCGCGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCAC
  5   1   2       bld Fat1      in                         CABC6614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGACGACTGCGCCCAGGGCCCAGAGTTCTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCANGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCAC
  5   1   2       bld Fat1      in                         CABC4262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGTGTCAGAACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACG
  5   1   2       bld Fat1      in                         CABC5503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAAATGCCTGGTTAGGAACAGATGTGCTGTGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGAAAAGAGATCCAGACTTTCC
  5   1   2       bld Lun1      in                        CABD12654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTGTGCAGTGTAAGCAGATTGTGAACATCCTGCTGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCT
  5   1   2       bld Fat1      in                        CABC11419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGACATGGTGAAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACTATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCANGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAA
  5   1   2       bld Lun1      in                        CABD12092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGGCATCCCCCATCCAGGACACCATTAAGAATTTCTTACACAAGCAGTGTTCCCACCTTCCCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGA
  5   1   2       bld Fat1      in                         CABC7714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGATTCAATTCGGCACGAGGCGTGGTTCCTCTCATTGCTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAATCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGNGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGAACCACGTGTGGCACTAAAGTTTTCTTCTGATNCTCTTTTC
  5   1   2       bld Fat1      in                        CABC11220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCAGTGCAACCTGCTGGTGGATCAATATGAAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCC
  3  -1   2       bld Fat1      in                         CABC5121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAACTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCCTCTGATCTTCTTTTCCTC
  5  -1   2       bld Fat1      in                         CABC4555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAATACACAATTATTTTACTAGATATAGTACTGAGAAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGGTGAGACGGGCAGAGGATGCATGGGAATGAGAAACAGAGAGGTAACGTTTGTGGCCACCGTGCCGCCACTGGCATGGACTCATTTTGGGACCTGGCTAAAAGCAAACTCATAAAAGCTTGATCTTTATAATGTGTAGGATCAAAACAAACCAATTATTACTTTAATCTGTCAAGTGCAAAAAGTCACAGATTGTGCAAATCCTGAACCTTAGTACGGTTTGTCTCAGGAAAGACAGAAATGTTATTTTAATAGTATTCATATGTAACAGAAATTCATTGTGACCCCCAGCTCCTTCTATGTACAAGGTTATCCCACTTTATAATTTTTTCTGTTCTTCCTCAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTCGG
  5   1   2       bld Lun1      in                        CABD12386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCACTGTCTTGGAAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAAATAATATGTTATGAATC
  3   1   2       bld Fat1      in                         CABC2037.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCA
  3   1   2       bld Fat1      in                         CABC9371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAACAAGTGAACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTGNCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAA
  3   1   2       bld Fat1 5g3  in                         CABC4690.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAA
  3   1   2       bld Lun1      in                        CABD13931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCCCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  5  -1   2       bld Lun1      in                        CABD12773.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAA
  3   1   2       bld Fat1      in                         CABC2160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGATTTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAAAA
  5  -1   2       bld Lun1      in                        CABD12808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTCTCTGTTCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTTCTTTT
  3   1   2       bld Fat1      in                         CABC5503.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTCCCTGAGACTTNGCAGCTCTGACCAAGCTGATTTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAA
  3   1   2      seed Lun1      in                        CABD13559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAA
  3   1   2       bld Lun1      in                         CABD9917.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  5   1   2       bld Fat1                                 CABC1148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCC
  3   1   2       bld Fat1      in                         CABC6736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  3   1   2       bld Lun1      in                         CABD9949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                        CABC11067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAA
  5  -1   2       bld Fat1      in                         CABC5121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAA
  5  -1   2       bld Fat1      in                         CABC6704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCCTGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTNTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGA
  3   1   2       bld Lun1      in                        CABD12386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCCTGAGACTTGCAAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATNATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD12092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAGACTTGNCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTAC
  5  -1   2       bld Fat1      in                         CABC7291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTT
  3   1   2       bld Fat1 5g3  in                         CABC7874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATG
  3   1   2       bld Fat1      in                         CABC9348.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGACTTTGCAGCTCTGACCAAGCTGATTTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAA
  5  -1   2       bld Lun1      in                        CABD12022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATCCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAAA
  5  -1   2       bld Lun1      in                         CABD9653.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTAATTTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATA
  3   1   2       bld Fat1 5g3  in                         CABC5092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGAAAAAATATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCNCATGTGCTGGATGTGCAAGTCCTNTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAAA
  3   1   2       bld Fat1 5g3  in                         CABC7752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAGACTTTGCAGCTCTGACCAAGCTGAATTCTGGAATAGTGAGCTGCTACAGGAAAAATTATCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAAATATGTTATGAATC
  3   1   2       bld Ovi1      in                         CABI5661.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCAGCTCTGACCAAGCTGATTTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC6271.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGACCAAGCTGATTTCTGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAA
  3   1   2       bld Lun1      in                        CABD10308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1      in                        CABC11220.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD10597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTATTTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  3   1   2       bld Lun1      in                        CABD11947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                        CABC11429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAATAGTGAGCTGCTACAGGAAAAATTATCCCCTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC7015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC1387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  5  -1   2       bld Fat1      in                         CABC5077.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGTGAGCTGCTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD13344.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGAGCTGCTACAGAAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCACNACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC8215.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGCTGCTACAGGAAAAATTATTCCCTTTATTCAGGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD12654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCTGCTACAGGAAAAATTATCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Egg  5g3  in                    TEgg021j06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTACAGGAAAAATTATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAAAAAAAAAAAAAA
  3   1   2       chi Lun1      in                        CABD12926.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAATACAGGTAAACATCCTATGCAGCAATGTTAGTATATTATAGACTACCATATGTGCCGTTGCTCTTCATCTTTTTAACAGTATTTCCAGTATAAATGTGTTTCCTTTAGGCAAGCATTTTTCTGATGCTTCTTTTGATGCCTACAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD10404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  3   1   2       bld Lun1      in                        CABD12524.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCCCTTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1      in                        CABC11419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  5  -1   2       bld Fat1      in                         CABC7031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCCCTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAACCTCGG
  3   1   2       bld Lun1      in                        CABD12545.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACCCAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC8091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTTTATTCAGGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCGTGTCTTTTAGCTATCAAGGCTTCTTTTTACATCCAATAAATAGTGTTATGAATC
  3   1   2       bld Fat1 5g3  in                        CABC11025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  3   1   2       bld Ova1 5g3  in                        CABE13193.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATNATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD13993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1      in                         CABC2107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                        CABC10506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTAATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  5  -1   2       bld Fat1      in                         CABC1677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCCTTAATTCAGGAGCATCTGTACACGCACATGTAAAGCANCACAGGGGAGAGTGAGGCGCAGATTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC8445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD12595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD12422.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCA
  3   1   2       bld Lun1      out                        CABD9664.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGGTGAGACGGGCAGAGGATGCATGGGAATGAGAAACAGAGAGGTAACGTTTGTGGCCACCGTGCCGCCACTGGCATGGACTCATTTTGGGACCTGGCTAAAAGCAAACTCATAAAAGCTTGATCTTTATAATGTGTAGGATCAAAACAAACCAATTATTACTTTAATCTGTCAAGTGCAAAAAGTCACAGATTGTGCAAATCCTGAACCTTAGTACGGTTTGTCTCAGGAAAGACAGAAATGTTATTTTAATAGTATTCATATGTAACAGAAATTCATTGTGACCCCCAGCTCCTTCTATGTACAAGGTTATCCCACTTTATAATTTTTTCTGTTCTTCCTCAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC5861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1      in                         CABC6614.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC7630.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                          CABC864.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAGATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD12800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAG
  3   1   2       bld Fat1 5g3  in                        CABC10772.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC5954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGAGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAA
  3   1   2       bld Fat1      in                         CABC7714.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGCATCTGTACAACGCACATGTAAAATCAACACAGGGGGAGAGTGAAGGCGCAGATTGCNCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAACGTC
  3   1   2       bld Fat1      in                         CABC4262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  3   1   2       bld Lun1      in                        CABD14829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATCTGTACAACGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  5   1   2       bld Lun1      in                        CABD14022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCACATGTAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGA
  3   1   2       bld Fat1 5g3  in                         CABC1641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAAGCAACCCAGGGGGAGAGTGAAGGCGCAGATTGCCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD12025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  5   1   2       bld Lun1      in                        CABD12025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAAGCAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCANAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                         CABC7900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  5   1   2       bld Fat1      in                         CABC7900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACACAGGGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCANAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1 5g3  in                         CABC1746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAGAGTGAAGGCGCAGATTTGCCAATCCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Fat1 5g3  in                         CABC1540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAAAGCCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  3   1   2       bld Fat1      in                         CABC8340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  5   1   2       bld Fat1      in                         CABC8340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCATGTGCTGGATGTGCAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Lun1      in                         CABD7422.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTCCTTTATGAGCCAATTAGAGGCAGTCATCCCAAAGACGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGTTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGGGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGGATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT
  5  -1   2       bld Int1      in                         CAAP1894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATTAGAGGCAGTCATTCCAAAGGCGGTCATTGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGGGTTTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTTCTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCCCAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTTTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTTTGCAATCAAACCCCCCATAAGGCAGAACCTGACCCCGGCAGAGGTAGAGGCCGCAGTTTTGAAAGCCCCCGGAGAGCCTGGCATGGCATGGAAAGAGATCCCGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGGGGGGCCCCAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGGTAATGCAGCCCCCCAGCCTTTTGGGTGCGCTGTGGGACAGTTTTATTGGGGTCGAAACCTGGAAACAGCTAAAGAGGGGGGGGCCCTCAGTCCCTGTTTGACCCACGTGGGGCCCTAAAGTTTTTTTTTGATTTTCTTTTCCTCAGTCCCCACCCCCTGTTTTTTAGCTATCAAGCTTCTTTTTACCTCAATAAATATGTTTTGGATCC
  3   1   2       bld Gas7      in                          XZG4017.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGGCCAAAGCAGCCACCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTCGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTCTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATG
  5  -1   2       bld Fat1      in                         CABC1965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACGGTCATGCCCAAAGCAGCCACCAAACTGTGCNTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  5   1   2       bld Gas7      in                          XZG4017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAAGCAGCCCCAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTCGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTCTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAAAAAAAAAAAGG
  5   1   2       bld Egg                            TEgg115g20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCT
  3   1   2       bld Lun1      in                        CABD12577.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTGTGCCTGATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTACTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTCTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTCTGCAATCAAACCCACCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATG
  3   1   2       bld Lun1      in                        CABD14022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCCTTCCAGCCTCAATAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAATTATTTTCCTAGATATAGTACTGGAGAAGCTGGGACCACAGCTGCTGTGCAAACTGCTGTTCATGTGTGCCACAGATGAGAACTGTGAGGCAGGTTTAACAGTGATACCAGTTTTGGATGCTGATTTTACCTGTGACACGTGCCTGGCCGTTACCTTTGCAATCAAACCCCCCATAAGGCAGAACATGACCCAGGCAGAGGTAGAGGCCGCAGTTTTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGTTAATGCAGCCCCACAGCATTTTGGGTGCGCTGGGGGACAGTTTTATTGGGGTGGAAACCGGGAAACAGCTAAAGAGTGGGGGGCCATCAGTCACTGTTTGACCCACGTGGGGCACTAAAGTTTTTTTTTGATTTTTTTTTCCTCAGTCCCCACCCCCTGTTTTTTAGCT
  3   1   2       bld Lun1      in                        CABD13010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCACCGTGCCGCCACTGGCATGGACTCATTTTGGGACCTGGCTAAAAGCAAACTCATAAAAGCTTGATCTTTATAATGTGTAGGATCAAAACAAACCAATTATTACTTTAATCTGTCAAGTGCAAAAAGTCACAGATTGTGCAAATCCTGAACCTTAGTACGGTTTGTCTCAGGAAAGACAGAAATGTTATTTTAATAGTATTCATATGTAACAGAAATTCATTGTGACCCCCAGCTCCTTCTATGTACAAGGTTATCCCACTTTATAATTTTTTCTGTTCTTCCTCAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  3   1   2       bld Fat1      in                         CABC1977.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCCGTTACCTCTGCAATCAAACCCACCATAAGCCAGACCATGACCCAGGCAGAGGTAGAGGCCGCAGTTCTGAAAGCCCACGGAGAGCCTGGCATGGCATGGAAAGAGATCCAGACTTTCCTTAAGAACCATCACACAGAACTGTCCCTCCTCCTGCACAAGCAGTGGGACCACAGGATGACGTGCCAGGCATTGGGGGCTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  3   1   2       bld Lun1      in                        CABD14036.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATC
  5   1   2       bld Lun1      in                        CABD14036.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGCCCAGCTCCTGCTAATGCAGCCCCACAGCATTCTGGGTGCGCTGTGGGACAGTCTTATTGGTGTCGAAACCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAAAAAAAAAAAAAA
  3   1   2       add Fat1      in                         CABC6730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAGCGCACCCAGAATGCTGTGGGGCTGCATTAGCAGGAGCTGGGCAAGCCCCCAATGCCTGGCACGTCATCCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTAGAATC
  5   1   2       add Fat1      in                         CABC6730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAGCGCACCCAGAATGCTGTGGGGCTGCATTAGCAGGAGCTGGGCAAGCCCCCAATGCCTGGCACGTCATCCTGGAAACAGCTAAAGAGTGTGGGGCCATCAGTCACTGTCTGACCCACGTGTGGCACTAAAGTTTTCTTCTGATCTTCTTTTCCTCAGTCCCCACCCCCTGTCTTTTAGCTATCAAGCTTCTTTTTACATCAATAAATATGTTATGAATCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (