Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 62%

 1012070423 Xt7.1-TTpA031n13.3 - 230 ESTs
                                                                       ......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA031n13.3                                                                                                                                                   TGTGCTCCGCCTCCTTTTCGGGAGGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221731                                                                                                                                                         CCGCCTCCTTTTCGGGAGGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAxAxxxAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                        3     4     5     6     8    14    15    20    21    26    31    37    42    50    63    76    77    85    82    90    85    93    87    93    88    95    92    97    92    97    94   100    94   100    94   100    92    99    92   100    94   100    97   101    96   101   100   102    98   101    99   102    99   101    98   103   101   107   104   107   103   109   106   111   110   115   117   122   118   123   115   125   124   130   129   136   134   142   136   142   140   147   145   152   145   153   150   158   151   157   154   160   155   161   160   164   161   166   158   165   161   166   167   172   168   175   169   174   163   172   162   172   157   167   156   164   149   164   152   164   149   164   149   160   151   159   150   159   149   158   143   155   140   152   139   153   136   151   137   150   139   150   132   145   130   144   120   139   120   137   119   133   119   133   114   131   115   128   112   125   115   125   114   125   113   123   113   123   116   124   114   121   116   119   108   113    85   116    45   116    43   116    46   116    45   116    46   115    43   114    47   114    43   114    43   113    42   107    44   106    39    97    35    88    33    85    14    53    17    37
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                               --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                       --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------A-A
                                               BLH MIN      66      76                                                                                                                                                   
                                               BLH MPR      51      76                                                                                                                                                   
                                               BLH OVR      87      29                                                                                                                                                   
                                               EST CLI      72      51                                                                                                                                                   
                                               ORF LNG      87       3                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 1e-010     NP_497701.1 mitochondrial glycoprotein (26.4 kD) (3E487) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dm ==== 1e-031     NP_611243.1 CG6459-PA [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 1e-033     XP_789452.1 PREDICTED: similar to complement component 1, q subcomponent binding protein precursor [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Gg ---- 2e-078     XP_415748.2 PREDICTED: similar to p32 subunit of splicing factor SF2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 5e-097     NP_001203.1 complement component 1, q subcomponent binding protein precursor;hyaluronan-binding protein 1; splicing factor SF2-associated protein; C1qglobular domain-binding protein [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 3e-099     NP_031599.2 complement component 1, q subcomponent binding protein [Mus musculus] ----------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                PREDICTED = Dr ==== 1e-102     NP_001017858.1 hypothetical protein LOC550556 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN -== ?? ==== 3e-103     NP_001082378.1 similar to complement component 1, q subcomponent binding protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                            PREDICTED - Xl ==== 4e-152     AAH45084.1 Similar to complement component 1, q subcomponent binding protein [Xenopuslaevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA031n13.3                                                                                                                                                                                                                                          ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------ATG------------ATG---------------------------TAA---------------------TGA---------------------------------------------------------------------------TAA------------------ATGTAA---------------------------TAG------------------------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       chi Ova1      in                         CABE7698.5p AAGGTTAAGAAAAAACACAAGCACTCTTTTGTGGAGCAGATCCCGGACAGTGACCTTGTCACTTGTATCTCATCCGAAGGATCTCTCACCAAAGGCCTTGTTATCTCTCAGGAAACTCCAAAGGCAAAAAAGCATAAAGCAAAACATCAGGAACATTTACTGCCTGGCAGTGGCTCAGGGTCATCCCAAAACAAGCACAAAAAGGCAAAAAGACACCATGAAAATGAACCAGATACTTTGGCTGCAGAACCCAAGATTAAAAAGAGACATAAAGAATGACATGTTTTTAACAATACTGTAAATTTGTATTTTCAAAAGCAAAAGTGTATTTTAATAATGTATGTGCCAATGTAAAAAATTATTTGGAAGTTTAAAAATCAAATATGTTTAGGAGTTCCACCTAAAAAAAAAAAAAAAAAACCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGA
  5   1   2       bld Gas0 5g                              dad32h05.y1                                                                                                   CCGGGAGCGACCTCTGCTTGTAGCCAAGGAGACCTTGACGACACTTCCTGTGCTCCGCCTCCTTTTCGGGAGGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCGAAGANGTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGCAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTTAACTGGTCAGAAAAATA
  5   1   2       bld Gas  5g3  in                   TGas128i04.p1kSP6                                                                                                                                     TTGACGACACTTCCTGTGCTCCGCCTCCTTTTCGGGAGGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAG
  5   1   2       bld Egg0 5g3  in                         dad66f07.y1                                                                                                                                     TTGTCGACACTTCCTGTGCTCCGCCTCCTTTTCGGGAGGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCC
  5   1   2       bld HeRe 5g3  in                     EC2CAA15BA05.g1                                                                                                                                                               GCTTTTCGGGAGGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAACGTCAGAAAGCTGAGGAGA
  5   1   2       bld HeRe 5g3  in                     EC2CAA26BH05.g1                                                                                                                                                               GCTTTTCGGGAGGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAAT
  5   1   2       chi AbdN      in                       IMAGE:7007295                                                                                                                                                                   CGGGAGGTGAAAGGTCAGGGGTGTGCACGGTGTCCTTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTNCACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGANCAGGCATTTGCTGAATTTCTCNAAGATGAAATCCAAGAAGAGAGAAAGATCGNGAAACNTAGGACCTTGCCCAAATGTCTGGGGGGGGGGAATTAGACATCAATGGCCCGAGGGCTAACTGGTCGAAAAAATTCAGGGGAAAGATTGGCAGTTACTTTCAACACAACAAAAGCATTTCCCCAAGTTTTAATGGGGGGGCCCCAAAAGGTTCAAAACCTTAAGGAAAAATAACCCTAAACTTGGGTTTTACCCCCCCATTTTTGTGTGTGGAAAATTTTCCAAAACGGGGGGACCCCCCCCCCCCCCCCGGGGTTTTTGGGGGGGGGCCCCTTTTTCCCCAAAAAAAAAAAAGGGTTTGGGGAACACTTGGGGGAAAAAAAAAAAGAC
  5   1   2       bld Egg  5g                        TEgg122a09.p1kSP6                                                                                                                                                                       GGAGGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAG
  5   1   2      seed TpA  5g3  in                   TTpA028l07.p1kSP6                                                                                                                                                                       CCGGGGAATCCCGGGGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTA
  5   1   2   22  bld Tad5 5g                              XZT25500.5p ........................................................................................................................................................................CCACGNNCGTCCGGGTGTCACNNGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATNCAGTTTCTAGAAAAC
  5   1   2       bld BrSp 5g3  in                      EC2BBA8CD10.g1                                                                                                                                                                          GGGGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCGCAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACT
  5   1   2       bld HeRe 5g3  in                     EC2CAA29BD08.g1                                                                                                                                                                          GGTGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACGCACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAG
  5   1   2       bld Egg  5g3  in                   TEgg025n12.p1kSP6                                                                                                                                                                           TGAAAGGTCAGGGGTGTCACGGTGTCCTCCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACAGAAACAATAGCATTCCACCAGGTTTTAATGAGGAGCCACA
  5   1   2       bld HeRe 5g                          EC2CAA46BB02.g1                                                                                                                                                                           GAAAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAAGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAACAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAAGCTGA
  5   1   2       chi AbdN                               IMAGE:7006797                                                                                                                                                                            TGAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGGAGGTTAAGCTTTCAGCCCACAGGAGATACAGAATGGAAAGGAGAACAGCTATACACTTAACACTGATTCACTTGNACTGGGCCCCTTTTATGATCACTTAAATGGGATTTTTTTGGCCTGGACCGTGGAAATGGAATTATTACCTTTTTGCCTGAATTAAGCCTAAGTGGGAAACTAAAGCACTGGCCTTTTGGAAACCACCCCAGGAAAATACATCCAAAGTTTTTTCTAAGAAAAAA
  5   1   2   10  bld Te1  5g3  in                        CBWN11991.b1 ............................................................................................................................................................................GAAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTT
  5   1   2       bld HeRe 5g                          EC2CAA32DA06.g1                                                                                                                                                                              GAAGGTCAGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGA
  5   1   2       bld HeRe 5g3  in                     EC2CAA33DB04.g1                                                                                                                                                                                     GGGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGG
  5   1   2       bld HeRe 5g                          EC2CAA45BG04.g1                                                                                                                                                                                      GGGGTGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTG
  5   1   2   20  bld Te1  5g                              CBWN6833.b1 ......................................................................................................................................................................................GTGGTCACGGTGTCCTCCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGA
  5   1   2       bld Tad0                               IMAGE:6986053                                                                                                                                                                                        AAAGGGGCTTGAGTACCGGGGTCCGAGAATTCCCGGGGATGGCCAAACTTAAAAAAGCAATGAAAAATGTCAAATTTATTTAAGTGCATTCTTCGATGTAATTTTATTTGCTGCTTTTGTTTTCTGCAGCATTTGCAGAGATCTGGGGGGGGGGGGGGAAATAAATGCTGAAAAGGAATCCCGGGCACAAGCAGACTTTCCTGAATCCTCAAAGTGGCTTCCCGGCCGTGTCCAGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAATAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAAGCTAAACTGGTCATAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAATACAAACAATAACATTCCACCAAGTTTTAATGAAGAGCCACAAGAAGGTCAGAAAGCTGATGAGAATGATCCTGATCTTGCGTCTACTCCAAATTTTGTTGTACAATTTACACAAATGGAAACCAACCACACCTTGGTACTTGACTGTTCCTATACCAGAAGACGAGAATGGTCAGGTCGAAGAAGATCTCAACGAGATTCTTTAATAACTTATAAATATATTTTATTATACAGATATTTTGAGAAAGTAAACAATTGACATATATACCTCACTCTAGGAATGTGTTTTCTGGAATGAATGTATTTAATATTCCTCACATTTTACGATTATAAATTTAGTACTACTATTTTATCATAATAAATATGCAAATACATAAAATAA
  5   1   2       bld Gas8 5g3  in                          st99h09.5p                                                                                                                                                                                          TGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGA
  5   1   2       bld In66 5g                         IMAGE:8965352.5p                                                                                                                                                                                          TGTCACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAAGGAGAACAGCTATACACTTACACTGATTCACTTGACTGGGCCCTTATGATCACTTAATGGATTTTGGCTGACCGTGGAGTGATAATACTTTGCTGATGAGCTAGTGGACTAGCACTGCTTTGAGCACAGGATACATCAGTTTCTAGAAACTAAGACTTGTATGCTAGAAGACTGGAAGCATCACTCTGTCTAGTTGCGTCAAGGAGAACTTGTGCATGTCATCTTGCATAATGGGACGTTTAATCCTGGTGAGTATGTGGTGTGA
  5   1   2       bld Tad0 5g3  in                     NISC_no05g11.y1                                                                                                                                                                                             CACGGTGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAG
  5   1   2   12  bld Tad5 5g3  in                         XZT68218.5p ................................................................................................................................................................................................GTCCTCTTGTCACACACACACGTGGGTATCTGCANGGACCATGGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATNCAGTTTCTAGAAAACCTTAAAG
  5   1   2   10  bld Limb 5g3  in                        CBSU5542.fwd .................................................................................................................................................................................................TGTCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGT
  5   1   2   12  bld Gas7 5g3  in                         XZG13282.5p ...................................................................................................................................................................................................TCCTCTTGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGNATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAG
  5   1   2       bld HeRe 5g3  in                     EC2CAA10CA06.g1                                                                                                                                                                                                          GGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGCCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAACTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCC
  5   1   2       bld HeRe 5g3  in                     EC2CAA20CE06.g1                                                                                                                                                                                                          GGTCACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTA
  5   1   2       bld BrSp 5g3  in                     EC2BBA12AD01.g1                                                                                                                                                                                                           GGGACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTT
  5   1   2       bld HeRe 5g3  in                      EC2BAA1BE05.g1                                                                                                                                                                                                             GACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACATTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCGGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCT
  5   1   2       bld HeRe 5g3  in                      EC2CAA1BE05.g1                                                                                                                                                                                                             GACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACATTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCGGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGA
  5   1   2       bld HeRe 5g3  in                     EC2CAA34DF08.g1                                                                                                                                                                                                             GACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCGCACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTCGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGGATTTTTTGGCTGA
  5   1   2       bld HeRe 5g3  in                     EC2CAA40AA05.g1                                                                                                                                                                                                             GACACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGG
  5   1   2       bld Gas  5g                        TGas128a12.p1kSP6                                                                                                                                                                                                               CCCGGGCACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATAC
  5   1   2       bld BrSp 5g3  in                     EC2BBA13AG12.g1                                                                                                                                                                                                               GGGACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGA
  5   1   2       bld HeRe 5g3  in                     EC2CAA12AG04.g1                                                                                                                                                                                                               GACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTC
  5   1   2       bld HeRe 5g3  in                     EC2CAA27CF04.g1                                                                                                                                                                                                                ACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAA
  5   1   2       bld HeRe 5g                          EC2CAA28AH08.g1                                                                                                                                                                                                                ACACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGG
  5   1   2       bld HeRe 5g3  in                     EC2CAA17CB01.g1                                                                                                                                                                                                                 GACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAAAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTT
  5   1   2       bld HeRe 5g3  in                      EC2CAA2CB07.g1                                                                                                                                                                                                                 GACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAGGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTT
  5   1   2   12  bld Gas7 5g3  in                         XZG36423.5p ................................................................................................................................................................................................................CACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAG
  5   1   2   10  bld Spl2 5g3  in                        CBSS6500.fwd ................................................................................................................................................................................................................CACACACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGA
  5   1   2       bld Gas  5g3  in                   TGas144f22.p1kSP6                                                                                                                                                                                                                     CGTGGGTATCTGCAGGACCATTGTTCTCCACACTTGTCCCGAGCTTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTT
  3  -1   2       bld Eye       in                         CCAX1393.g1                                                                                                                                                                                                                     CACGTGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAAGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTG
  5   1   2       bld Gas  5g                        TGas009i06.p1kSP6                                                                                                                                                                                                                         TGGGTATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTG
  5   1   2       bld TpA  5g3  in                   TTpA019f07.p1kSP6                                                                                                                                                                                                                         CCCCGGGTGCAGGACCATGGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACA
  5   1   2       bld Neu  5g3  in                   TNeu127e23.p1cSP6                                                                                                                                                                                                                          TGGGTATCTGCAGGACCTGTTCTCCACACTGTCGCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTGCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTGACTATCCAAGGATGAAGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTC
  5   1   2       bld Tad0 5g                            IMAGE:6986032                                                                                                                                                                                                                          CCGGGATCTGCAGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGANTTTTTGGCTGACCGTGGAGTGGATATACTTNTGCTGATGAGCTAGTGGAACTAGCACTGCTTTGGAGCACCAGAATACATNCAGTTTCTAGAAAACCTTAAGACTTNGTAANTGCTN
  5   1   2       bld Gas  5g                        TGas037p06.p1kSP6                                                                                                                                                                                                                           TGGGTATCTGCAGACATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAAAAGATGAGGTTGGACATGGGGAAGAAGAAGAAGAAAGTGACATTTTTACTATTCG
  5   1   2       bld Egg0 5g                              dad75e07.y1                                                                                                                                                                                                                             CCGGGGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGACATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAAAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGACAGCGACCATTTTACTATTCCGGAGGTTAGC
  5   1   2   10  bld Tbd1 5g3  in                        CBXT11554.b1 ............................................................................................................................................................................................................................TATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACGCGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAAGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAA
  5   1   2   10  bld Lun1 5g3  in                         CABD1804.5p .............................................................................................................................................................................................................................ATCTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATNCAGTTTCTA
  5   1   2       bld TpA  5x3  out                  TTpA031p15.p1kSP6                                                                                                                                                                                                                                CTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCNTAGAAGACATTGAGAAGCAATCACCTTCTGT
  5   1   2       bld TbA  5g3  in                   TTbA033m10.p1kSP6                                                                                                                                                                                                                                CAGGACCATGGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCCACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCTTCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACCAGGCATTTGCTGAATTTCTCAAAGATGAAATCGAAGAAGAGAGAAAGATCCAGAAACATAAGGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTCAAACTGTGTCCCAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCGCAAGAAGGTCTGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCGATTATGTTGTAGAAGTTACGAAACTGGATACCAACCGCACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACTTGGGGAATAAGAGGAACACAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCATCCCACAGGAGATACAAAATGGAACGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGACTGGATAATACTTTTGC
  5   1   2   10  bld Liv1 5g3  in                         CAAR5419.5p ...............................................................................................................................................................................................................................TTGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCA
  5   1   2       bld Tad0 5g3  in                       IMAGE:6982997                                                                                                                                                                                                                                 CCCGGGATCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATATACTTTTGCTGATGAGCTAGTGGAACTAGCACTGCTTTGGAGCACCAGAATACATCAGTTTCTAGAAACNTNAAGACTTNGTAAATGCTAGAG
  5   1   2       bld BrSp 5g3  in                    EC1CBA002ZG10.g1                                                                                                                                                                                                                                 GGGAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTTAC
  5   1   2   14  bld Te5  5g3  in                         CAAO1429.5p ................................................................................................................................................................................................................................TGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACTTANAGACTTTGTTAAATG
  5   1   2       bld Ova1      in                        CABE13769.5p                                                                                                                                                                                                                                 TCAATTCGGCACGAGGTCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATNCAGTTTCTAG
  5   1   2   30  bld Tail 5x3  out                        CBSW8911.b1 ................................................................................................................................................................................................................................TGCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGAT
  5   1   2       bld Egg  5g3  in                   TEgg006f11.p1kSP6                                                                                                                                                                                                                                  GCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTC
  5   1   2       bld Egg  5g3  in                   TEgg048d14.p1kSP6                                                                                                                                                                                                                                  GCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAA
  5   1   2       bld Egg  5g                        TEgg122b08.p1kSP6                                                                                                                                                                                                                                  CAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGAGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATA
  5   1   2   12  bld Tad5 5g3  in                         XZT51271.5p .................................................................................................................................................................................................................................GCAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAG
  5   1   2       bld Egg  5g3  in                   TEgg050i14.p1kSP6                                                                                                                                                                                                                                   CAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAG
  5   1   2       bld Egg  5g3  in                   TEgg059h04.p1kSP6                                                                                                                                                                                                                                   CAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAGTGAGCCTGAGCTTGTGTCTA
  5   1   2       bld Egg  5g                        TEgg097n20.p1kSP6                                                                                                                                                                                                                                   CAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGACGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAAT
  5   1   2       bld Egg  5g                        TEgg122b04.p1kSP6                                                                                                                                                                                                                                   CAGGACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGA
  5   1   2       bld Gas1 5x3                           IMAGE:6989212                                                                                                                                                                                                                                   TGCGGACATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAAACCTTAAAGACTTTGTTAAATGCTAAAGAAGACATTGAGAAAGCAATCTACCTTCTTGTTCTAAAGGTTTGCGGCCCAAAGGGAGGAATCTTGTTGCATTGTCATCCTTGCATAAATGGACATTTTTAAAATCTGGTGGGGATGTGTTGGTAAAAAATCGGGAACGA
  5   1   2       bld Neu  5g                        TNeu049i13.p1kSP6                                                                                                                                                                                                                                    CAGGACCTGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGG
  5   1   2       bld Gas  5g                        TGas008d07.p1kSP6                                                                                                                                                                                                                                     CAGGACCTGTTCTCCACACTGTCCCGAGCTCCCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTTCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACT
  5   1   2       bld TbA  5g3  in                   TTbA079k17.p1kSP6                                                                                                                                                                                                                                     CAGACCTGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAANACCTTAAAGAC
  5   1   2       bld Egg  5g3  in                   TEgg028b24.p1kSP6                                                                                                                                                                                                                                      GACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCATGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTG
  5   1   2       bld Neu                            TNeu137e11.p1cSP6                                                                                                                                                                                                                                      CAGGACCTGTTCTTTCACTGTCCCGAGCTCTCTTATCCGCCCACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAAGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGGTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTGTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTGAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTG
  5   1   2       bld TpA  5g3  in                   TTpA015i10.p1kSP6                                                                                                                                                                                                                                      GACCATGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTG
  5   1   2   12  bld Gas7 5g3  in                         XZG22651.5p .........................................................................................................................................................................................................................................TGGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGGCTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGA
  5   1   2       bld Egg                            TEgg051f03.p1kSP6                                                                                                                                                                                                                                           CCCGGGCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTA
  5   1   2       bld Tail      in                         CBSW9987.b1                                                                                                                                                                                                                                           GGTTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACC
  5   1   2       bld Egg                            TEgg119f21.p1kSP6                                                                                                                                                                                                                                             TTCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATA
  5   1   2       bld Egg       in                   TEgg009f16.p1kSP6                                                                                                                                                                                                                                              TCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATA
  5   1   2       bld Egg       in                   TEgg009f17.p1kSP6                                                                                                                                                                                                                                              TCTCCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCA
  5   1   2       bld Gas8                                   st1d01.5p                                                                                                                                                                                                                                              CTCCACACTGNTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCG
  5   1   2       bld Ski1      in                         CABJ3050.5p                                                                                                                                                                                                                                                 CCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAANACCTTANAGACTTTGTNTAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGT
  5   1   2       bld Gas7      in                         XZG34319.5p                                                                                                                                                                                                                                                 CCACACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTTGTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGGTCT
  5   1   2       bld Hrt1      in                        CAAQ10349.5p                                                                                                                                                                                                                                                     ACTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAANACCTTANAGACTTTNGTAAATGCTAAGAAGACATTGAGAAAGCATCACCTTCTGTTCTAAAGGTTGCGGC
  5   1   2       bld Mus1      in                        CABH10263.5p                                                                                                                                                                                                                                                      CTGTCCCGAGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTANAGACTTTGTTAAATGCTAAGAAGACATTGAGAAAGCATCACCTTCTNGTCTAAAGGTTGCGGCCAG
  5   1   2       bld Gas                            TGas012j16.p1kSP6                                                                                                                                                                                                                                                        TCCCGCGCTCTCTTCTCCGCCACACGGGCTAGCGGCCCGTACGGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTTGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAAGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAAATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACA
  5   1   2       bld Liv1      in                        CAAR10622.5p                                                                                                                                                                                                                                                              AGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCT
  5   1   2       bld Ova1      in                         CABE2817.5p                                                                                                                                                                                                                                                              AGCTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCA
  5   1   2       bld Ova1      in                         CABE7579.5p                                                                                                                                                                                                                                                                CTCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAGGGTG
  5   1   2       bld Egg       in                   TEgg052k10.p1kSP6                                                                                                                                                                                                                                                                 TCTCTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTT
  5   1   2       bld Mus1      in                         CABH3835.5p                                                                                                                                                                                                                                                                    CTTATCCGCCACACGGGTAGCGGCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGA
  5   1   2       bld Egg       in                  TEgg057m02.p1kaSP6                                                                                                                                                                                                                                                                                          GCCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGAAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCT
  5   1   2       bld Lun1      in                        CABD14653.5p                                                                                                                                                                                                                                                                                           CCGTACGGCCCCAACAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGA
  3  -1   2       bld Kid1      in                         CABA9448.3p                                                                                                                                                                                                                                                                                                         CAGCTGCTGAGCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGC
  5   1   2       bld HeRe                             EC2CAA45DF09.g1                                                                                                                                                                                                                                                                                                              GCTGATCTCTTTGTGCACCGGACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCGGACTTTCCTGCCTCCTCAACGTGCCTTACAGGCCGT
  5   1   2       bld HdA       out                 THdA024c05.p1kbSP6                                                                                                                                                                                                                                                                                                                              CCGGACGATCCTTCTCGCGCTCATTATGTTTGCTCGGGGGAAATCCGAGGGCTCCTGCACACTTTCCTGCATCCTCAACGTGGCTTGCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGACGGTGACCTGGCATTTGCTGATGTTTCTCAAAGATGACATCGTTGAGCATAGAGAGATCCAGATTCATAACATCCTTCCCTAAATGTCTGGTGGGTGGGAATTA
  5   1   2       bld Ova1      in                         CABE6686.5p                                                                                                                                                                                                                                                                                                                                  GACGATCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAANACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTANATCTGTGGGATGTGTTGTAAAATCGGAC
  5   1   2       bld Tad5      in                         XZT25146.5p                                                                                                                                                                                                                                                                                                                                       TCCTTCTCACGCTCATTATGTTTGCTCGGGGGGAATCCGGGGCTCAGGCAGACTTTCCTGCATCCTCAACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTANAGACT
  5   1   2       bld Gas7      in                         XZG55113.5p                                                                                                                                                                                                                                                                                                                                                                                     CGGACGCGTGGGCGGACGCGTGGGTGGATGTACATTTTTTGTCTGTTCTTCGCGTCTGCCTCCCAGACATTTGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGGCAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAAT
  5   1   2       bld Ski1      in                        CABJ10470.5p                                                                                                                                                                                                                                                                                                                                                                                                          AACGTGGCTTCCCGGCCGTGTCCTGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTNCAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCT
  5   1   2       bld Ova1      in                         CABE5639.5p                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCCCGGCCGTGTCCTGTGGGTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCCTAAAGACTTTGTTAAATGCTAACAAGACATTGAGAAACAATCCCCTTCTGTTCCAAAGGTTGCGGCC
  5   1   2       bld Ova1      in                         CABE9464.5p                                                                                                                                                                                                                                                                                                                                                                                                                            CCGAGGGTGGCTGTGGGGGACTGCACACTGAGGGTGACAAGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAATTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAANCAGTGTCANAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACCTATG
  5   1   2       bld TpA       in                   TTpA014g07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCGGGGGCATTTGCTGAATTTCTCAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCT
  3   1   2       bld AbdN      in                       IMAGE:7007295                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGAAACCCCCTCCCTCCCCAAAAAATGTTTTTGGGGGGGGGGGGGGAAATTTAGGACCTCCCAATGGGCCCCCAGAGGGGTAAAAACTTGGTCCTGGAAAAATATTCCCGGTGGAAAAAGATTTGCGGTTTCTTTTCAACCCCAAACCATTAGCATTCCCCCCCAAGTTTTATTGAGGGGCCCCCACGAAGGTCCTGAAAAGCTGAGGGGAATGAGCCTGAGCTTGTGTCTACCACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCACCCCCACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCCCAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATA
  5   1   2       bld Liv1      in                         CAAR9936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGATGAAATCAAAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGAC
  5   1   2       bld TbA       in                   TTbA042n12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCTTCGCAAACAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAGATGCGTCAAAGGCTATTGAGGTGGATGGAGGTGACGTGAAAGCACTATTCAGGCGCAGCCAGGCCTTGGAGAAACTTGGCCGAGTAGACCAGGCAATAATTGATCTTCGCCGATGCCTTACTCTAGAGCCAAAAAACAAAGTTTTTCAAGAGGCTGTGAGAAACCTTGGAATTCGTGCTCAAGAGAAAGTTAGTGAGATCAAATTATGTGGCAATAAGTCATGATTTGCTTTTAAATTGTAGCTCAATAAATAATGGAGACATAAATGCAAACATCTATTTTTCTAGACACAAGGTGTGTCTTTAGAAAGGTCCCAAACAGGCACTGAAACCTTGACAAATAAATACATTTTGGTTTTTC
  3   1   2       bld TbA       in                    TTbA042n12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCTTCGCAAACAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAGATGCGTCAAAGGCTATTGAGGTGGATGGAGGTGACGTGAAAGCACTATTCAGGCGCAGCCAGGCCTTGGAGAAACTTGGCCGAGTAGACCAGGCAATAATTGATCTTCGCCGATGCCTTACTCTAGAGCCAAAAAACAAAGTTTTTCAAGAGGCTGTGAGAAACCTTGGAATTCGTGCTCAAGAGAAAGTTAGTGAGATCAAATTATGTGGCAATAAGTCATGATTTGCTTTTAAATTGTAGCTCAATAAATAATGGAGACATAAATGCAAACATCTATTTTTCTAGACACAAGGTGTGTCTTTAGAAAGGTCCCAAACAGGCACTGAAACCTTGACAAATAAATACATTTTGGTTTTCAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld TbA       in                   TTbA042n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCTTCGCAAACAGAAGAGAGAAAGATCCAGAAACATAAGAGCCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGATTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAGATGCGTCAAAGGCTATTGAGGTGGATGGAGGTGACGTGAAAGCACTATTCAGGCGCAGCCAGGCCTTGGAGAAACTTGGCCGAGTAGACCAGGCAATAATTGATCTTCGCCGATGCCTTACTCTAGAGCCAAAAAACAAAGTTTTTCAAGAGGCTGTGAGAAACCTTGGAATTCGTGCTCAAGAGAAAGTTAGTGAGATCAAATTATGTGGCAATAAGTCATGATTTGCTTTTAAATTGTAGCTCAATAAATAATGGAGACATAAATGCAAACATCTATTTTTCTAGACACAAGGTGTGTCTTTAGAAAGGTCCCAAACAGGCACTGAAACCTTGACGAATAAATACATTTTGGTTTTTC
  3   1   2       bld TbA       in                    TTbA042n18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCTTCGCAAACAGAAGAGAGAAAGATCCAGAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAGATGCGTCAAAGGCTATTGAGGTGGATGGAGGTGACGTGAAAGCACTATTCAGGCGCAGCCAGGCCTTGGAGAAACTTGGCCGAGTAGACCAGGCAATAATTGATCTTCGCCGATGCCTTACTCTAGAGCCAAAAAACAAAGTTTTTCAAGAGGCTGTGAGAAACCTTGGAATTCGTGCTCAAGAGAAAGTTAGTGAGATCAAATTATGTGGCAATAAGTCATGATTTGCTTTTAAATTGTAGCTCAATAAATAATGGAGACATAAATGCAAACATCTATTTTTCTAGACACAAGGTGTGTCTTTAGAAAGGTCCCAAACAGGCACTGAAACCTTGACAAATAAATACATTTTGTTTTCAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld HeRe 5g3  in                      EC2BAA1BE05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCAGAAACATAAGAACTTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCGGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTT
  3   1   2       bld BrSp 5g3  in                      EC2BBA8CD10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAACATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCGCAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCT
  3   1   2       bld TpA  5g3  in                    TTpA019f07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATAAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg050i14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAACCTTCCCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACGTTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTGAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCAACTGTTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas128i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAAAATGTCTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTAATGTATTATTTTTTAATAAATATATTTCAGAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                         CABJ3050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGTCTGGTGGGTGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAAAAA
  5   1   2       bld TpA       in                   TTpA003e21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTGTGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTT
  3   1   2       bld HeRe 5g3  in                      EC2CAA1BE05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCGGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTA
  3   1   2       bld Egg       in                    TEgg057m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTCAGAAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg048d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTGTTTTTTAATAAATATATTTCAGAAACAGATCTAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                        CABJ10470.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGGGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld Egg  5g3  in                    TEgg059h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACCACAAACAATAGCATTCCACCAAGNTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACCACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE9464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGAATTAGACATCAATGGCACAGAGGCTAAATTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCT
  3   1   2       bld Gas  5g3  in                    TGas144f22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA015i10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA028l07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACCGAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5x3  out                   TTpA031n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5x3  out                   TTpA031n20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTAGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1 5g3  in                         CAAR5419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGACATCAATGGCACAGAGGCTAAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATAATTTCAGAACCT
  3   1   2       bld Te5  5g3  in                         CAAO1429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAG
  3   1   2       bld Ova1      in                         CABE6686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTACTTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld Liv1      in                        CAAR10622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAG
  3   1   2       bld Liv1      in                         CAAR9936.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGTCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGA
  5  -1   2       bld Kid1      in                         CABA9448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGAAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTG
  3   1   2       bld TpA       in                    TTpA014g07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTTCTATTCGGGAGGTTAGCTTTCAGCCCCCAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTTTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA12AD01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAA
  3   1   2       bld Ova1      in                         CABE7579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAAATATCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAAC
  3   1   2       bld Tad0 5g3  in                       IMAGE:6982997                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATATCAGGTGAAAAGATGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATATCCCG
  3   1   2       bld Mus1      in                        CABH10263.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAA
  3   1   2       bld Hrt1      in                        CAAQ10349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld Lun1 5g3  in                         CABD1804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCT
  3   1   2       bld Ova1      in                         CABE5639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGTGAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld HeRe 5g3  in                      EC2CAA2CB07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGTTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTGCTTATGTAAGGCTTCATCT
  3   1   2       bld HeRe 5g3  in                     EC2CAA10CA06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAACTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTGCTTATGTAAGGCTTCATCT
  3   1   2       bld HeRe 5g3  in                     EC2CAA17CB01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTGCAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGGTCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTGCTTATGTAAGGCTT
  5   1   2       bld Gas7      in                            XZG19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATTGCAGTTACTTTCACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAATAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATG
  3   1   2       bld BrSp 5g3  in                     EC2BBA13AG12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATTAAGGCTTCATCTATT
  3   1   2       bld Ova1      in                        CABE13769.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld Limb 5g3  in                        CBSU5542.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTACTTTCAACACAAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCNTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld Gas7      in                         XZG55113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld Lun1      in                        CABD14653.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTT
  5   1   2       bld Gas                            TGas015f14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGCATTCCACCAAGTTTTAATGAGGAGCCACAGAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGTAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATNTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTT
  3   1   2       bld TpA       in                    TTpA053o09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTCAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld HeRe      in                     EC2CAA12BB03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAA
  5   1   2       bld TpA       in                   TTpA053o09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTCCCCAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAAACAGTGTNCAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTNAACCCACTTTATGTTAGACAACCCTTTTG
  3   1   2       bld TbA  5g3  in                    TTbA079k17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTTTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCCCCCCCTGGTTTTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTATTATTCGGGAGGTTAGCTTTCAGCCCCCAGGGGATACAGAATGGAAGGGGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGGGGATAATACTTTTGCTGATGAGCTAGTGGAATTAAGCACTGCTTTGGAGCCCCAGGAATACATCAAGTTTTTAGAAAACCTTAAAGACTTTGTTAAATGTTAAGAAGACATTGAGAAGCAATCCCCTTTTGTTTTAAAGGTTGCGGCCAGAGGAGGATTTTGTTGCATGTCTTTTTGCATAATGGACATTTTAAATTTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAATTCATCCATAACAAAAATGGTGTTTATTTATGTAACAAGATTTGTTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCGGAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG36423.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAAC
  3   1   2       bld Tad5 5g3  in                         XZT68218.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACGG
  3   1   2       bld Mus1      in                         CABH3835.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTTAATGAGGAGCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTT
  3   1   2       bld Spl2 5g3  in                        CBSS6500.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAATGAGGAGCCACAGAAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAAC
  3   1   2       bld Tbd1 5g3  in                        CBXT11554.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCCACAAGAAAGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGACAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                            XZG19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAATAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATT
  3   1   2       bld Tad5 5g3  in                         XZT51271.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACGG
  3   1   2       bld HeRe                             EC2CAA18BA01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTGCTTATGTAAGGC
  3   1   2       bld Te1  5g3  in                        CBWN11991.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE7698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAAGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTT
  3   1   2       bld Gas7 5g3  in                         XZG13282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAAGGTCAGAAAGTTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAGCGACGCCCTGGTTCTTGATTGTCACTATTCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGTCCACAGGAGATACAGAATGGAAGGAGAACAGCGATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCCCCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATATATTATTTTTTAATAAATA
  3   1   2       bld Ova1      in                         CABE2817.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGTCAGAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGGAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld Gas7      in                         XZG34319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAAGCTGAGGAGAATGAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAGAAATACCGAAAAAAAAAC
  3   1   2       bld HeRe 5g3  in                     EC2CAA26BH05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTAGTAAGGC
  3   1   2       bld HeRe 5g3  in                     EC2CAA20CE06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCTGAGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTT
  3   1   2       bld HeRe      in                     EC2CAA12BB03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTTGTGTCTACACCCAAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTGCTTATGTAAGG
  3   1   2       bld HeRe                             EC2CAA13CE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTT
  3   1   2       bld Tad5      in                         XZT25146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAAC
  3   1   2       bld HeRe 5g3  in                     EC2CAA15BA05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGTGTCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTT
  3   1   2       bld Tail      in                         CBSW9987.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTACACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg028b24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAATTTTGTTGTAGAAGTTACAAAACTNGGATACCAACCACACCCCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAAAAGAAAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA12AG04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGT
  3   1   2       bld Egg                             TEgg037k03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATANTTTCAGAAACAGAAAATATAAGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg009f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAATTTTGTTGTAGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg009f17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu127e23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGTTACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe                             EC2CAA44CG02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAAACTGGATACCAACCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAA
  3   1   2       bld Gas7 5g3  in                         XZG22651.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACACCCTGGTTCTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTT
  3   1   2       bld Mus1      in                         CABH8376.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAAC
  5   1   2       bld Mus1      in                         CABH8376.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg006f11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg052k10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTCAGAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FL   ?                     TEgg004l09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ggggtcgctgaccccggcggccaggccctgttgctctgtggggctccagttttattgttgttgttgctttttgttccttgtctttctattcagcccctcccctgttcatatgccagtctcccattgaaacaactccctggttgctggggtgggttgcaccgtagcaaccggatggctgctgaagctggagagctgctgagcaatgggtgaaagtattcaagggccacagatggtggagggtgaagaccaattgcagatggtctcagaatatctctctctgcatcgtactaaaagttaactcaGGTGACCGACTCCTTTTCATATTTTGGATATTAAAATGAAAAGTGATAAAAATATTTTTGTTATAATAAAAAAAAAAAAAAAAAAAAGCGGCGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg025n12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA077l02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTCACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas0                                 dad51g09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTAAAAAAAATTTCAGAAACAGAAAAAAA
  3   1   2       bld Gas8 5g3  in                          st99h09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACNATCCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCNCNGGNGATACNGAATGGAAGGNGAACAGCTATACNCTTAACNCTGATTCACTTGACTGGGCCCTTTATGATCNCTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCNCTGCTTTGGAGCNCCNGGAATACNTCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACNTTGAGAAGCAATCNCCTTNTGTTNTAAAGGTTGCGGCCNGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACNTTTTAAATCTGTGGGATGTGTTGTAAAATNGGACAGATTTAAAATTGTGAAAAGGCNAGNGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAGAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTGTTTTTTNGCTTATGTAAGGCTTCATC
  3   1   2       bld Egg                             TEgg007i13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCAGAGGATGAGGTGGGACATGGGGAAGAAGAGGAAGAAAGTGCCATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGTTATACACTTAACTCCGATTCACTTGTCTGGGCCCTTTATGATCACTTAATGGATTTTCTGGAGGACCGTGGAGTGGATAATACTTTTGCCGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCCCCAGGAATACTATCAAGTTTTTAGAAAGCCTTAATGACTTTGTTAAATGCTACGAAGGCATTGATAAGCAATCACCTTCTGTTATAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAACATCGGGCAGATTTAAAATTGAGAAAAGGCAAGAGGTTTTTTTTTGGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTATATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTCATGTAAGGCTTCATCTATTATTTTTAAATAAAAATATTTCAGAAACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA33DB04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGAGGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAG
  3   1   2       bld HeRe 5g3  in                     EC2CAA34DF08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGAGGTCGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGCCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTAGTAAGGCGTCATCTATTATT
  3   1   2       bld Gas0                                 dad48d01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCCCAGAAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTGTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTAATAAAAAATTTCAGAAACAGAAAAAAAA
  3   1   2       bld TpA       in                    TTpA003e21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACATGGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCNCAGGAGATACAGAATGGAAGGAGAACAGCTATTCCNCCTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTGTGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad0 5g3  in                     NISC_no05g11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTTAAAAAAAAAAAAAAAAAG
  5   1   2       bld Gas8      in                          st97a15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGAAGAAGAGGAAGAAAGTGACATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACNTNCTATANCAAANGNCAAAGTANGTANAAAACAAAANCANCCATAACAAAAANGGNGNCTATNGATGTANCAAGATTTGCTTAANCCCACTTATGTTTANACANCCCTTTTGTTTTTTTGCTTATGTAAGGCTTCANCTATAATTTTTTAATAAATATATT
  3   1   2       bld Gas0                                 dad23a10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTTACTATTCGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAA
  3   1   2       bld Gas7      in                         XZG38790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGTTAGCTTTCAGCCCCCAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCCCCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCCCCTTTTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAACCGG
  3   1   2       bld Egg0 5g3  in                         dad66f07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGAGGTTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTAATAAATATATTCAGAAAACAGATCTAACTCTTAAAAAAA
  5   1   2       bld Gas7      in                         XZG38790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAGCTTTCAGCCCACAGGAGATACAGAATGGAAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAA
  3   1   2       bld Egg0                                 dad61e01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTTCCACCCCCAGGGAGATCCAGAAGGGAAGGGGACCACCTATACGCTTAGCCCTGATTCACTTGGCGGGGCCCTTTATGATCACTTAATGGATTTTTTGGCGGACCGTGGAGTGGATAATACTTTTGCTGATGAGCAAGTGGAACTAAGCACTGCTTTGGAGCACCCGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAAT
  3   1   2       bld Gas7      in                         XZG44103.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGCCCACGCGTCCGGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAAAAAAAAAG
  5   1   2       bld Gas7      in                         XZG44103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCGCGTCCGGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAA
  5   1   2       bld Egg                            TEgg083p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGGAGAACAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAG
  3   1   2       bld HeRe 5g3  in                     EC2CAA40AA05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGAACTAGCTATACACTTAACACTGATTCACTTGACTGGGCCCTTTATGATCACTTAATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTT
  3   1   2       bld Gas8      in                          st97a15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGNCTGGGCCCNTTATGNTCANTTAATGGATTTTTTGGCTGNCCGNGGAGTGGATAATNCTTTTGCNGNTGAGCTAGTGGAACTNAGCCCTGCTTTGGNGCNCCNGGAATACATCAAGTTTCTAGAAAACCNTAAAGACTTTGTTNAATNNTAAGAAGNCNNTGNGNAGCNATCCCCTTNTGTTNTAAAGGTTGCGGCCNGAGGAGGNTCTTGTTGCATGTCATNTTGCNTAATGGNCNTTTTAAATCTGTGGGATGNGTTGTAAAATNGGACNGATTTAAAATTGTGAAAAGGCNAGNGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAANTGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCT
  5   1   2       bld Tad5                                 XZT47242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTTAATGGATTTCTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGA
  5   1   2       bld Egg                            TEgg120j15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTGGCTGACCGTGGAGTGGATATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACTT
  3   1   2       bld Tad5      in                         XZT63943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAG
  5   1   2       bld Tad5      in                         XZT63943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGAAAAAAAAAAAAAAAGG
  3   1   2       bld BrSp 5g3  in                    EC1CBA002ZG10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACTTTTGCTAATGAGCTAGTGGAACTAAGCACTGCTTTGGAGCCCCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCCCCTTCTGTTCTAAAGGTTGCGGCCAAAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAAAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAACTTCTTAAAACCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                        CBXT22133.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT22133.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAACTAAGCACTGCTTTGGAGCACCAGGAATACATCAAGTTTCTAGAAAACCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGATCTAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA033m10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTGGCGCACCAGGAATACATCAAGTTTTTAGAAAACCTTAAAGATTTTGTTAAATTCTTAGAAGGCAATGAGAAGCAATCCCCTTTTGTTTTAAAGGTTGCGGCCAGAGGAGGATGTTAGTTTCACCTCATTTTGCATAAAGGACATTTTAAATATGGGGGATGCGTTGTAAAATTGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTAACATTTTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCTTAACAAAAAGGGGGTTTTTTTATGTAACAAGATTTGTTTAAACCCACTTAAGGTAGACAACCCTTTTGTTTTTTAGCATAGGTAGGCCTCATTTATTATTTTTTAATAAAAATGTTCAGGAACGGGGGAAAAAACAAAGAACATAAAAAAAAAAAAAAA
  3   1   2       bld TpA                             TTpA012l23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTTAAAGACTTTGTTAAATGCTAAGAAGACATTGTGAAGCAATCCCCTTCTGTTTTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGGGTGTAAAATCGGACAGATTTAAAATTGTGAAAAGCCAAGAGGTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGGGTCTATTTATGTAACAAGATTTGCTTAAACCCTCTTTTGTTTAGACACCCCTTTAGTTTTTTTGATAATGTAAGGATTCATCTACTATTTTTTAAGAAATAATTTCAGAACCAGGTCCAATTGCGAGGGCGATAATTAAAAAAAAAGAAAAAAAAA
  5  -1   2       bld Eye       in                         CCAX1393.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGCTAAGAAGACATTGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACAT
  3   1   2       bld HeRe 5g3  in                     EC2CAA29BD08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATTGAGAAGCAATCACCTTTTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCAAAAATGTTTAGACAACCCTTTT
  5   1   2       bld Egg                            TEgg096i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGAAGCAATCACCTTCTGTTCTAAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTTTGTTTTTTACATTCTATAACAAATGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAG
  5  -1   2       bld Egg                            TEgg036i12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGGTTGCGGCCAGAGGAGGATCTTGTTGCATGTCATCTTGCATAATGGACATTTTAAATCTGTGGGATGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGCCC
  5  -1   2       bld Egg                            TEgg036f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGGGAGGTGTTGTAAAATCGGACAGATTTAAAATTGTGAAAAGGCAAGAGGTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAGCCC
  3  -1   2       bld Gas                             TGas116d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTTTTTTTTTTTTTTACATTCTATAACAAATGGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTGATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAAC
  3  -1   2       bld TbA       out                   TTbA003e24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTTTTTTTTTTTTTTTTCATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTATTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAAAAACAGATCTAACTTCTTAAAACTT
  3   1   2       bld HeRe 5g3  in                     EC2CAA27CF04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTGTTTTTTACATTCTATAACAAGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTT
  5  -1   2       bld TbA       out                  TTbA003c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATTGGTATAACAATGTGTCAAAGTATGTAGAAAACAAAATCATCCATAACAAAAATGGTGTCTTTTTATGTAACAAGATTTGCTTAAACCCAGTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATGTATTATTTTTTAATAAATATATTTCAGAAACAGATGTAACTTCTTCAAACTTAAAAAAAAAAAAAAAAAGCGG
  5  -1   2       bld TbA                            TTbA059k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATCAAAAATGGTGTTTATTTATGTAACAAGATTTGCTTAAACCCACTTATGTTTAGACAACCCTTTTGTTTTTTTGCTTATGTAAGGCTTCATCTATTATTTTTTAATAAATATATTTCAGAAACAAAAAAAAAAAAAAAAAAGCGAATCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)