Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012070480 Xt7.1-TTbA042f10.3 - 216 ESTs
                                                                       .-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA042f10.3                                          CCTTTCTGTCACACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221803                                                TGTCACACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCxAxxxAAAAAAAAAAAA
                                                      consensus depths                                               4     5     7     8     8     9    11    11    18    19    22    24    33    36    39    43    49    52    50    52    59    59    60    60    60    61    63    63    64    64    64    64    64    64    65    65    65    65    65    65    66    67    67    67    67    67    68    68    68    68    68    68    68    68    70    70    70    71    70    71    71    71    72    73    73    73    73    73    72    73    73    73    72    73    74    75    74    75    73    75    74    75    74    75    74    75    73    74    72    74    69    72    70    72    70    72    70    72    69    71    70    72    70    73    70    73    69    74    67    72    67    72    66    71    66    70    63    68    62    67    60    65    59    64    59    63    60    64    61    65    59    63    59    63    58    63    54    62    51    57    47    60    47    60    43    55    33    44    31    42    33    40    33    40    29    36    29    36    30    37    29    33    24    28    25    28    22    24    22    24    22    23    22    24    22    25    24    26    24    26    24    27    25    27    25    26    24    26    24    26    21    23    22    22    22    22    22    22    23    24    24    24    23    23    23    23    23    23    23    23    23    23    24    25    25    26    26    27    27    28    25    26    25    26    25    27    25    28    25    28    25    28    25    28    26    29    26    29    26    29    28    30    28    31    28    32    29    35    28    35    30    35    32    36    33    37    53    60    62    70    69    78    80    86    83    88    85    90    86    94    85    93    91    94    93    96    96    99    96   100    96   100    96   101    96   102    99   103    99   104   100   106    98   106   103   108   105   110   107   113   107   113   107   115   109   114   109   115   109   115   108   115   108   117   112   116   112   115   112   116   110   115   112   114   112   115   111   115   107   114   111   113   108   113   106   113   105   112   109   112   109   113   111   113   108   113   110   113   107   112   102   112    99   111   105   108   105   108   103   107   102   107   102   107   102   107   102   107   103   108   102   107   103   107   101   106   100   106    98   104    95   100    87    97    82    94    60    91    17    29
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                      ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                               BLH ATG     124     590                                          
                                               BLH MIN     124     357                                          
                                               BLH MPR      85     357                                          
                                               BLH OVR     124      28                                          
                                               CDS MIN     124      30                                          
                                               EST CLI      69      30                                          
                                               ORF LNG     124      11                                          
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ==== 1e-155     CAA72283.1 heat shock protein 70 [Ciona intestinalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED - Sc ==== 0          NP_012579.1 Nuclear-encoded mitochondrial protein; member of the heat shock protein 70(HSP70) family; most similar to E. coli DnaK protein; acts as a chaperone forprotein import across the inner membrane; subunit of Endo.SceI endonuclease;Ssc1p [Saccharomyces cerevisi ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 0          NP_504291.1 heat shock protein (70.8 kD) (hsp-6) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN --- Dm ---- 0          NP_523741.2 Heat shock protein cognate 5 CG8542-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PREDICTED - Sp ---- 0          XP_781277.1 PREDICTED: similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT) isoform 1 [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Dr ---- 0          NP_958483.2 heat shock protein 9B [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Gg ---- 0          NP_001006147.1 similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT) [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN --- Mm ---- 0          NP_034611.1 heat shock protein, A; heat shock protein cognate 74; heat shock protein, 74kDa, A [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN --- Hs ---- 0          NP_004125.3 heat shock 70kDa protein 9B precursor; heat shock 70kD protein 9; stress-70protein, mitochondrial; 75 kDa glucose regulated protein; peptide-bindingprotein 74; mortalin, perinuclear; p66-mortalin [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Xl ==== 0          AAH45259.1 Similar to heat shock protein, 74 kDa, A [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          NP_001079627.1 similar to heat shock protein, 74 kDa, A [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          CAJ82069.1 heat shock 70kDa protein 9A [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA042f10.3                                                                            TAG------TGA---------------------------TAGTGA---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------TAA------------------------------TAA------------------------TAG---TGA------------------------------------------------------------------TAG---------------------------------------TAA
                                                                   ORF                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  0   1   1           BrSp FLt3                 EC2BBA33DH09.FL-Pollet                                                     GACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCagCGAcaGGCGACAaaagaTGCtGGGcaaatTTCTGGGCTGAATGTCTTGAgAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGActagataaatctgatgaCAAAaTTattgcgGtctatgatcttggGggaggaACATTTGATAtttcgatTCTAGaaattcAGAAGGgggttTTTGAagtAAAATCCACAAaTGGAGACACATTccttggaGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAaacttcttggtcagtttacattggttggaatcccccctgcgcctcgtggagtgcctcagatgannagtcactttaaagtg
  5   1   1           Tbd0 FL                     IMAGE:5336625.FL-MGC                                                             TGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg043g04.FL-Sanger                                                                                                                            TTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ7128.5p CATCGATTCAATTGGCACGAGGGTTTTTACCTTGCTTTTAACCTTTCTGTCACACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGANGTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATT
  5   1   2       bld HdA  5g                        THdA045o01.p1kSP6      AAATGTGAGAGGAATCGGGTTTTTACCTTGCTTTTACCTTTCTGTCACACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATT
  5   1   2       bld In62 5g                         IMAGE:8956452.5p         ACACACCAAATCATTTAACTACAAATATTAGCCCTCTTTATTCGTCCCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCCTGGAAGTATAATGAACTACTGCGCTGCCCTTGCCTATGGACTAGATAATCTGATGACAAATTATGCGTCTATGATCTGGGGGAGAACATTGAATTTCCGATTCTGAATCGAAAGGGGTTTTGAGTAAAATCCACAAATGTGGGAGAAACCACTTCT
  5   1   2       bld BrSp 5g                          EC2BBA24CF12.g1                               GGGGCTTTTAACCTTTCTGTCACACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTC
  5   1   2   22  bld Gas7 5g                              XZG41338.5p .................................GCTTTTAACCTTTCTGTCACACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCCACAGGCGACAAAGGATG
  5   1   2   10  bld Te1  5g3  in                         CBWN9795.b1 ..........................................CTTTCTGTCACACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACA
  5   1   2       bld BrSp FLt3                        EC2BBA33DH09.g1                                                  GGGACCCACGTGGTTAAGATGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTC
  5   1   2   14  bld Te3  5g3  in                         CAAM7579.5p ....................................................CACCCACGTGGTTAAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGAT
  5   1   2       bld TpA  5g3  in                   TTpA067d10.p1kSP6                                                                GTTAGAGGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAAT
  5   1   2   12  bld Tad5 5g3  in                         XZT29756.5p .....................................................................GGCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATC
  5   1   2   24  bld Te5  5g                              CAAO1815.5p ......................................................................GCTTCTAGAAGTGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAA
  5   1   2       bld Egg  5g3  in                   TEgg023m19.p1kSP6                                                                                  TGCTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTA
  5   1   2       bld Tbd0 5g3  in                     NISC_nl13a09.y1                                                                                    CTGAAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGG
  5   1   2       bld HdA  5g                       THdA002c01.p1kbSP6                                                                                       AAGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAANTTATTGCGGTC
  5   1   2   14  bld Brn3 5g3  in                         CAAK3353.5p ......................................................................................AGGGTTTCTTTTCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGAGCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGGCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCC
  5   1   2   10  bld Limb 5g3  in                         CBSU600.fwd .......................................................................................AGGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGC
  5   1   2       bld AbdN 5g                            IMAGE:7024806                                                                                         GGGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACNAAATTATTGCGGTCTATGAATCCTGGGGGGGAGGGAACATTTTGATATTTTCGATCTAGAAATCCCCAAAAAGGGGGGT
  5   1   2       bld Gas  5g                        TGas133k23.p1kSP6                                                                                          GGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAACTATTTGGGTCACGCTGCCCAAAATGCTGTTATCACTGTGCCTGC
  5   1   2   24  bld Brn4 5g                             CAAL22263.5p .........................................................................................GGTTTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTNTGGGGAGGAACATTTGATATTTCGATTCTA
  5   1   2   10  bld Ovi1 5g3  in                        CABI13393.5p ............................................................................................TTCTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCA
  5   1   2       bld Lun1      in                         CABD7895.5p                                                                                               CTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCA
  5   1   2   10  bld Mus1 5g3  in                          CABH704.5p ..............................................................................................CTTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAA
  5   1   2       bld Tbd0 FL   in                    IMAGE:5336625.y1                                                                                                TTTCCTGCTGGTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCA
  5   1   2       bld In66 5x                         IMAGE:8965681.5p                                                                                                  CGGGTAACTAGACCCTAAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTAATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAAACCCCAACAACACATTCTACGCAACAAAAGCGCCTCATTGGCCGACGTTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTTCCCCAAGTCAGATTTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTTCACGCTGCCCAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGAACAAAGGATGCTGGGCAATTTCTGGGCTGAATGTCTTGAAAGTAATAATGAATCTAACTGCCGCTGCCTTGCCTATGGAACTAGAATATTCTGATGACAAAATTATTGCGTCTATGATCCTGGGAAGAACATTGAAATTTCGATTCTAGAAATCCGACGGGGTTTTGAGTAAAATCACAATGAAACCATTCCTGAGTGAGAATTTGATCAGCTTGGCTTGCACCATATTGTTAAGC
  5   1   2   10  bld Spl2 5g3  in                        CBSS2208.fwd .........................................................................................................GTACTGACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT17477.b1 ..............................................................................................................GACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCCAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTTCTAGAAATTCAGAAAGGGGTTTTTGAG
  5   1   2   10  bld Tbd1 5g3  in                         CBXT4543.b1 ..............................................................................................................GACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCCAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGGAG
  5   1   2   10  bld Tbd1 5g3  in                         CBXT5225.b1 ..............................................................................................................GACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCCAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATG
  5   1   2       bld TpA  5g                        TTpA011k20.p1kSP6                                                                                                                ACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGC
  5   1   2       bld TbA  5g3  in                   TTbA042m03.p1kSP6                                                                                                                ACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGNGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATT
  5   1   2       bld HdA  5g                       THdA025d14.p1kbSP6                                                                                                                ACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAANTTATTGCGGTCTATGATCTTGGGGGGGAGGAACATTTGATATTTCGATTCT
  5   1   2       bld Sto1      in                         CABG6998.5p                                                                                                                ACCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAAATCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGA
  5   1   2       bld In63 5g                         IMAGE:8962069.5p                                                                                                                 TACGTCGAAGGTCCCCAAGTCTCCCTGTGTGACTTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGTCTATGATCTGGGGGAGACATTTGAATATTTCGATTCTAGAAATCAGAGGGGTTTGAGTAATCCACAATGAGACCATCTGAGTGAGATTTGATCAGCTTGCTGCACCTATTTGTAAGCCATTTCCAAGAAAAGC
  5   1   2   10  bld Tail 5g3  in                         CBSW5366.b1 ................................................................................................................GCTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGA
  5   1   2       bld Gas1 5g3  in                     NISC_mq21a08.y2                                                                                                                  GATGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTC
  5   1   2   12  bld Gas7 5g3  in                         XZG63889.5p .................................................................................................................CTAGTGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTC
  5   1   2       bld TbA  5g3  in                   TTbA078k15.p1kSP6                                                                                                                      AAATTCTGAAGGGGCTAGAACCACACCTTCTTTAGTAGCGTTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTT
  5   1   2   10  bld Liv1 5g3  in                         CAAR2889.5p .....................................................................................................................TGAAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGACATTTGATATTTCGATTCTAGAAATCA
  5   1   2   10  bld Ski1 5g3  in                        CABJ12103.5p .......................................................................................................................AAGGTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAG
  5   1   2       bld Egg  FL   in                   TEgg043g04.p1kSP6                                                                                                                           GTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTC
  5   1   2       bld Ovi1      in                         CABI1771.5p                                                                                                                           GTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGNGGTTTTTTGAGTAAAATCCACAAATGGAGACACATTCCT
  5   1   2   10  bld Ski1 5g3  in                        CABJ11637.5p ..........................................................................................................................GTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCA
  5   1   2   22  bld Tad5 5g                              XZT37147.5p ..........................................................................................................................GTTCCCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTC
  5   1   2       bld Tbd0 5g                            IMAGE:6979374                                                                                                                               ATCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATTATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTAACACTGTGCCTGCATACTTCATGAATCTCAACGAACAGCAAAAAAGATGCTGGGGAAATTTTCGGGCTGATGTTCTGGAATTTAATATGAACCTATGGCCCTGCCCTTGCCTTGGACCAAAAAAATCTGAGAAAAAATTTTTGGGGCTTAATTTTGGGGGGA
  5   1   2       bld TbA  5g                        TTbA039e12.p1kSP6                                                                                                                               CCCCGGGCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGANATTCAGAAAGGGGGTTTTTGAAGTANAATCCACAAATGGAGACACATTCCTTGNAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCA
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ9892.5p ..............................................................................................................................CCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGNGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGT
  5   1   2   10  bld Spl1 5g3  in                          CABK522.5p ..............................................................................................................................CCCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATT
  5   1   2       bld TpA  5g3  in                   TTpA024j22.p1kSP6                                                                                                                                CCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTNTGGGGGAGGAACATTTGATATTTCGATTCTA
  5   1   2   10  bld Liv1 5g3  in                        CAAR11401.5p ...............................................................................................................................CCAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCCTCAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTC
  5   1   2       bld HdA  5g                        THdA019k02.p1kSP6                                                                                                                                 CAAGTCTCCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTTGAAGTAAATCCACAAATGGAGACACATTCCT
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ9754.5p .......................................................................................................................................CCCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTG
  5   1   2   12  bld Tad5 5g3  in                         XZT63615.5p ........................................................................................................................................CCTGTGTGACTGTATCTATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGT
  5   1   2       bld HdA  5g3  in                   THdA053n21.p1kSP6                                                                                                                                                         TATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTTGGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAAGGGGGGTTTTTGAAAGTAAATCCACAAATGGAGACACATTCCTTGGAGGGTGAAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTANAGCAGTTCANAAGAGAGTCTGGTGTGGACCTTA
  5   1   2   30  bld Liv1 5x3  out                        CAAR2470.5p ........................................................................................................................................................TATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTTGTAAGCAGTTCAAAGAGAGTCTGGTGTGGA
  5   1   2   12  bld Tad5 5g3  in                         XZT45088.5p .........................................................................................................................................................ATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTC
  5   1   2   12  bld Tad5 5g3  in                         XZT69543.5p .........................................................................................................................................................ATCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGNGGTTTTTGAAGTANAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAG
  5   1   2   10  bld Limb 5g3  in                         CBSU896.fwd ..........................................................................................................................................................TCGGTCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCCAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCA
  5   1   2       bld Lun1      in                        CABD14244.5p                                                                                                                                                               TCTCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGGTC
  5   1   2   10  bld Liv1 5g3  in                        CAAR12512.5p ................................................................................................................................................................TCATCATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTA
  5   1   2       bld Tad5      in                           XZT686.5p                                                                                                                                                                      ATGCTGACTGCCAGCGGGTCCGTAGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTTGCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATG
  3  -1   2       bld Int1      in                         CAAP2134.3p                                                                                                                                                                                       GCGAGAGGCCTCGTCCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTAC
  5   1   2       bld Int1      in                         CAAP6670.5p                                                                                                                                                                                               CCTCGTGCCGCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGA
  5   1   2       bld Int1      in                         CAAP1637.5p                                                                                                                                                                                                     CCCTCTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCNTTGCTGCAGCATATTGTAAAGCAG
  5   1   2       bld Ovi1      in                         CABI5577.5p                                                                                                                                                                                                         CTCACATGTGTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGNGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCA
  5   1   2       bld Tad5      in                         XZT55095.5p                                                                                                                                                                                                                                               ATGGTCTCAGCCAAGATGTTCTGCAATCAGTGTTTAAACGGGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTAC
  5   1   2       bld TbA       in                   TTbA071c07.p1kSP6                                                                                                                                                                                                                                                                                       GGACTATGCATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCANAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCANAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATNCATCTGCCATACCTCACCATGGATGCTTCTGGGACAAAACACTTAAATATGAAATTGAC
  5   1   2       bld Neu                            TNeu046o23.p1kSP6                                                                                                                                                                                                                                                                                         CCCGGGGATCTGAATCAATTAAAGGTGCTGTCATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGNGGTTTTTGAAGTAAAATCCACANATGGAGACACATTCCTT
  5   1   2       bld TpA       in                   TTpA016k05.p1kSP6                                                                                                                                                                                                                                                                                                                        CATTGGTATTGATCTAGGAACAACAAATTCTTGTGTTGCCATAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGNAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAACACTAAAATATGAAATTGA
  5   1   2       bld HdA       in                   THdA042m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                      GAGGGAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGCGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTT
  5   1   2       bld Liv1      in                        CAAR12487.5p                                                                                                                                                                                                                                                                                                                                                                          GAAAGCAAGCAAAGGTCCTTGAAAATTCTGAAGGGGCTAGAACCACACCTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTTAATATGAAAATGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAT
  5   1   2       bld TpA                            TTpA025j22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                          TCCTTTAAAATTCTTAAGAACTAAAACCACACCTTCAATACTACCNTTTTCATCAAATCCTTAACATTTATTCCAAATTCCATCTAAACAACACGCACCCACTAACCCCAACAACACATTCTACACAACATAACACCTCATTCCCCTACATTTTCATTACCCTCAATTTCTAAAACACATTAAAAATCTACCTTTCAAAAT
  5   1   2       bld TpA       in                   TTpA021k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGGTTCAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAANAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTNGACATCATCTGCCATACCTCACC
  3   1   0       chi TpA       out                  TTpA049l12.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTAGTAGCGTTTTCATCAGATGCTGAACGTTTAGTGGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATGTAAGTTAATTCTTTGAGAAGGGTTTTGCAATTTAACAGATATTACTTATGGTAAAAAAAAAATCTGCATCCTGTATAGGTGAAGTAAGACATAACTTCACAGATAAAGCAAGTAAAGTGCATGTTTTATTGAAACTTCTGACACACAACTTTTCACATTTGAAATAGAACGATGTCCTGTAATTAGATGGTGCAGTAAAGAGTTTTACCACTTGGTTTATCCTGCATTAGGAAATCTCCAGTAAATGATACTTGAAAGAAAGGGTAATGGCACCACCCCCATATTATCAAATGAAAATAATGGACCATGCTCCCCAAGAAATGTAAATGTGTAAATGTGTGTATGCATGTATTTCTATAATTGTATATATAATAAGAATTTAGTTGACTGCACCTCTGTCAGGAACCAGTGTGCTTTTTTTGTGCCATCAGGATAGGCCTGGTCCTACTTTCATGAGCCACTGACCACTGAAGTGAAACAGCCAGGCAGGTATCTGTATAAAACAGAAAGAAGCTTTATTTCAGCTCTGGCAGATAAAAAGGCAAATAAAAAGTTAGGTGCTGAAACAGGCAGGCAGGCAGGCAGGCAATCAATCACAGGAAAACTCCAAGCAGACAGGGGTCTCAGAATCGAGGTACTGGTAGTGTCAACA
  5   1   2       bld Mus1      in                         CABH9744.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTAACCCCAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGA
  5   1   2       bld Neu                            TNeu017k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACAACACATTCTACGCAACAAAGCGCCTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACATTAAAAATGTACCTTTCAAAATTGTGAAAGCCTCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGTTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTG
  5   1   2       bld Tad5                                 XZT58176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGACGCGTGGGCGGACGCGTGGGCAAATGGCGATGCCTGGTTGGAATCCCATGGAAAACTGTATTCCCCAAGTCAGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAG
  5   1   2       bld Hrt1      in                         CAAQ1607.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATTGGCGCATTTGTTTTAATGAAAATGAAAGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTTGATCAGCTTTGCTGCAGCATATTGTAAAGCAG
  5   1   2       bld TbA       in                   TTbA013i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGCATTTGTTTTAATGAAAATGACCATTTTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCATCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAAAAATTCAAAATGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGACTTTGCTGCAACATATTGTAAAGCAGTATCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCATTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAGAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACC
  5   1   2       bld Tad5                                 XZT71887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGACTGCTGAAAACTATTTGGGTCACGCTGCCAAAAATGCTGTTATCACTGTGCCTGCATACTTCAATGACTCTCAGCGACAGGCGACAAAGGATGCTGGGCAAATTTCTGGGCTGAATGTCTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCANAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATC
  5   1   2       bld Tbd0                               IMAGE:6981045                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGAGAGTTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAACACTACTATACCNACCAAAAAAGCCAGGGTCTCTCTACTGC
  3  -1   2       bld Mus1      in                         CABH1031.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATTAATGAACCTACTGCCGCTGCCCTTGCCTATGGACTAGATAAATCTGATGACAAAATTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAGTTCATCAAGGAGAGAG
  5   1   2       bld HdA       in                   THdA050p09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTTTTTCCTCCTGTTTTAGTATTGCGGTCTATGATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGGTTGGA
  5   1   2       bld BrSp      in                     EC2BBA21BH05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTCTTGGGGGAGGAAACATTTGATATTTCGATTCTAGAAATTCAGAGGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAAGATTTTGATCAAGCTTTGCTTCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGCGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAAAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGTGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTAT
  5   1   2       bld Tad5      in                         XZT61639.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATC
  5   1   2       bld TpA                            TTpA066f01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGC
  5   1   2       bld TpA                            TTpA066g02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATC
  5   1   2       bld Eye                                  CCAX3527.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGGGGGAGGAACATTTGATATTTCGATTCTAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGGTGTTGGGACCCTTACCCAAAGACAATATGGGCACTTT
  5   1   2       bld TpA                            TTpA015n11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGAAATTCAGAAGGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGGAATTGTTCATGTATCTGNCAAAGACAAAGGGACAGGCCGT
  5   1   2       bld Bone      in                         CBTC728.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        NNTCCGGGGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGT
  5   1   2       bld Tad5                                 XZT44331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAATGGAGACACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGGATCCCCCCTG
  5   1   2       bld Ova1      in                        CABE13509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACATTCCTTGGAGGTGAAGATTTTGATCAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCANATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAG
  3  -1   2       bld Ski1      in                         CABJ3302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGATAAGCTTTGCTGCAGCATATTGTAAAGCAGTTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCANATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACANATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAAGATGCAGAAAAGTATGCAGAGGAGGATAGAAG
  5   1   2       bld TpA       in                   TTpA005h01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGGCTGGTGTGGACCTTACCAAAGACAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGA
  3  -1   2       bld TpA                             TTpA002m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTCGAGCTGCTGAAAAGCAAATGTGAGCTGTCTCTCCGNCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATG
  5   1   2       bld Gas       in                   TGas064b08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGGGGGAAAAAGCAAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCT
  5   1   2       bld Hrt1      in                        CAAQ12015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAATGTGAGCTGTCTTCCGCTTTGCAGACTGACATCAATCTGCCATACCTCACCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGNAGGCGGTTAAACATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGG
  5   1   2       bld TpA       in                   TTpA011i12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGACTGACATCAATCTGCCATACCTCTCATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTGCTCAGTTTGAGGGAATTGTTGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAANAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCA
  5   1   2       bld Tad5      in                         XZT43640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTGATTTAATAAAGAGGACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGNCACAAACTTAAAGAAGAGATAAGNCAGGTAAAAGAACTCCTGACACGAAAAGA
  5   1   2       bld TpA       in                   TTpA065a24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGCCCCGGGTGCACCTAGCCAAAAAGTTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATATCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAANAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATG
  5   1   2       bld Lun1      in                         CABD4468.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACAGTTGCACCTAGCCAAAAAGCTATGCAAGACGCAGAAGTTGGCAAAAGTGACATTGGTGAAGTTTTGTTGGTCGGTGGAATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACANACTTAAA
  3   1   2       bld Ovi1      in                         CABI5577.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGGTGGAATGACAAGAATGCCAAAGTTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACC
  5   1   2       bld TbA       in                   TTbA042f10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGACAAGAATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGANAGAAGCAGCACT
  5   1   2       bld Ski1      in                         CABJ9426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGCCAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAANAGAGGACCAGAAGGAAG
  5   1   2       bld Tad5      in                          XZT5240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGA
  5   1   2       bld Tad5      in                          XZT5804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTGGAGCTGCCATTCAAGGTGGCGTGTTAGCAGGAGATGTTACAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGANATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGGGACACAANAGAGGACCCAGAAGAAG
  5   1   2       bld TpA       in                   TTpA028g20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGATGAAGCAATTGCCATTGGAGCTGCCATTCGATGTGGCGTGTTACCAAGAGATGTTACTGATGACTTGTTGAAGGATGTCACACCACTTATCTCTTGGCATTGAAACACTTGTAGGAGTCTTTACCACGCTGATTGGAACAAACACTACTATACCATCCAAAAAAAGCCAGGTCTTCTCTACTGCTGCCGATGGCCAAACACTTGTTTATTTTTTAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGNCACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTTCATCACTC
  5   1   2       bld Gas7      in                         XZG46775.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAAGGTTCAGCAAACCGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCCGTAAATCCGGATGAAGCAGTTGCCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTG
  5   1   2       bld Tad5      in                         XZT67505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGATGTCTTGTTGTTGGATGTCACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACANANAGAGGACCAGAAGGA
  5  -1   2       chi TpA                            TTpA013h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATGTAGAGAATACATAGAATATACATCACAATGAAGCTTTACAGAATGATGGCTCTTGCAAGACTTATGTAAGACGGTTCATCACATATCATGACATCGTTCATTTCCTGAAGGAGGCAGTTTGTGAGCAAAACATTAGAACTGCACCTAATCCTATGAATCTCGTCATTCTGAAAACTTTTGTTTTGCTGAGGCACCCAGACCTTGACAACTTGTACATGAAGTGACTCAATACTAAGGATTTATTAAGTCCGTAGGCAAAACTTAAACTACAGAAATAAACCTCTCACTAGACCCCAACAACACATGCACAGATATAAACACACATATAAATCTGTATAACATAAAAAATATTTGTACCTCTTTTTTTTCCCTCTAGATTAAAACAAAATAACTAGCAAGTTAAGGTGCAAAACAGGAAGCAAAATATCTTTTGGGGGGTTATTTTTTAATACACAAAGTCAATAATGGATTTACCCAAGGATCATAGTCCAGATGATGAGTGCTACCATCTTAAAGAAGAGCTATAGCACGGTAAAATAACTCTTGACAGGAAAAGAAGAAGAAACTGGGGAGACCATCAGATATGTTTCATCATCTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGTCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATAAAAAAA
  5  -1   2       bld Int1      in                         CAAP2134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTT
  3   1   2       bld Egg  FL   in                    TEgg043g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGAAACACTTGGAGGAGTCTTTACCAAGCTGATGGAAAGAAACACTACTATACCNAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATAAAAAAAATCCACGTAAAAAAAAAAAAAAAAAA
  5   1   2       chi Tad0      in                       IMAGE:6983013                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGTCTTTACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAGATGGCTTCTGAAAAACCCCCCCTGAAGTGGGCACCAAAAGGGGACCAAGGGGGAAACCCTTAAGGGGTTGGGGCAAAGGCCTGGGATTAACTTTCAAATGAAATTCCCATCCCGGAAAAAATCCAAAATTTTTGGTTTTTGGAACTCTTAGGTGGGG
  3   1   2       bld TbA       in                    TTbA042f10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCAAGCTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA       in                   TTbA051k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGCTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACGACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTC
  3   1   2       bld TbA                             TTbA067n02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATTGGAAGAAACACTACTATACCAACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       chi Fat1      out                        CABC5055.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGGATGGCTGCATACCGGAGATATTGGCAAATGGCTACCAAACGGCACTCTTAAGATTATAGACAGAAAAAAACACATCTNTAAGCTGGCACAGGGGGAATACATTGCACCAGAGAAAATCGAAAATGTCTACACTAGAAGTGAGCCGGTGGTACAGGTTTTTGTCCATGGAGAGAGTTTACAGGCATTTTTAGTTGGTATTGTGGTGCCTCGTGCCGAATTCGGCACGAGGAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATGCCTCTCG
  3   1   2       chi HdA       in                    THdA050p09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCAAAAAAAGCCAGGTCTTCTCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAAGTAGGCATGCATATTAGTTTACACATGCACCTTATTTTTATTTGCTGTTATAGATTTCCTATATAGTCAGTGGCAAGTGATCAGCAAAAATGTCTAGGGTTTTGACTTGGTACCTAAAAGTCAAGCCATTAAGATGTGGCTTAAAAAAAATCTTTCCTTTCCGCAGTCACAATGCACACAGTGGCTAAACCTAAGCCCCAGGCATAATTACATCAATCCCAATACATTTTATGCCAGCCTAAGAAAAATGCTACTGTAAACCCTAAACAGATTATGCTGCGACTGTACACAGATCTTTATACCAGTTCCTTACTATTTGGTATATTTGCCTTCATATGCCAAGCTACTGCCCTGCTCTGTGCCCAGAATTTCCTTCCTGCCCTTTTCATGTTTGGGAAACGGTAAGGCAAAGTTAAGAATAGTAGCTTTTAGTGTATTATATATAATACTTCCACACTTTTTTTATTAATTAAAATAAAAAAAAATTGGCACTTTGTTTTTGCTTGCTATACACAAAGTTTTTAGCTTTTTTAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Int1      in                         CAAP1637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACA
  3   1   2       bld Liv1      in                        CAAR12487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCTTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAA
  3   1   2       bld Int1      in                         CAAP6670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Hrt1      in                        CAAQ12015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGCTGCGGATGCCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTG
  3   1   2       bld Hrt1 5g3  in                         CAAQ9892.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACGTCAAA
  3   1   2       bld Mus1      in                         CABH9744.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAA
  3   1   2       bld Ovi1                                 CABI7071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Ski1 5g3  in                        CABJ11637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2      seed Ski1 5g3  in                        CABJ12103.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTG
  5  -1   2       bld Ski1      in                         CABJ3302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Lun1      in                         CABD7895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCC
  3   1   2       bld Ova1      in                        CABE13509.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTG
  3   1   2       bld Sto1      in                         CABG6998.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGG
  3   1   2       bld Ski1      in                         CABJ9426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGCCCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Lun1      in                        CABD14244.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCGT
  3   1   2       bld Hrt1 5g3  in                         CAAQ9754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Gas       in                    TGas064b08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATAAAAAAAATCCACTGTCAAAAAATAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA016k05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACGTCAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA013i20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCCGAGGAGGATTGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTTTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAACTAAAAAAAATCCATCTGTCCATTCCTGGAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tad5 5g3  in                         XZT63615.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAAAGG
  3   1   2       bld TbA  5g3  in                    TTbA042m03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTTTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATTTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCT
  3   1   2       bld HdA  5g3  in                    THdA053n21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCGTAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Lun1      in                         CABD4468.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld TpA       in                    TTpA021k08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACGTCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA065a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAATCCACTGTCCATTCCTGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA078k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TpA       in                    TTpA028g20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGCGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTANCAAATAAATAATATAAAAAAAANNTNCCANCTGTCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT45088.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGCCAACACAGGTAGAAATTAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad0      in                       IMAGE:6983013                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATAAAAAAAACCACTCCTC
  3   1   2       bld HdA       in                    THdA042m09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGGGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCAGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGGAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ovi1      in                         CABI1771.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCC
  3   1   2       bld Gas1      out                      IMAGE:6981477                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               NAAACACAGTTGGAAATTAAAGTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCTCGTGCGCCTCGTGGAGTGCGTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTCTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTGTTATGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGATGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCCGTTGTTTTAGTCGGATATTCGTTTTTTCTTTTCTTCTACAAGATAATAACACACCAA
  3   1   2       bld Hrt1 5g3  in                         CAAQ7128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTG
  3   1   2       bld Spl1 5g3  in                          CABK522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACACAGGTAGAAATTAAAGTTCATCANGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT69543.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACACAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCGGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAAAAAAAAAGG
  3   1   2       bld TpA  5g3  in                    TTpA024j22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACGTCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT5804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAAAATTAAAGTTCTTCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTTC
  3   1   2       bld Tbd1 5g3  in                        CBXT17477.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTTGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAAAAAAAAA
  3   1   2       bld TpA       out                   TTpA032l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAAATAAAAAAAATCCACTGTCCATTCCT
  3   1   2       bld Limb 5g3  in                         CBSU896.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTTGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGCC
  3   1   2       bld TbA       in                    TTbA051k19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTTTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGGGACCATCAGAAATGTTTCATCAACTTTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATTTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTCCAAATAATAATGAAAAAAAATCCCCTTCAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT61639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACCCGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTTTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATTTGAAAGAAGCAGCCCTGAAAGTGGACAACAAAAAGAGGGCCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCCCCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTTCTACAAATAATAATTAAAAAAAATCCCCTGTTCATTCCTGTGG
  3   1   2       bld Liv1 5g3  in                         CAAR2889.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAAAGTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAAATGCACTGTC
  3   1   2       bld Ovi1 5g3  in                        CABI13393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAGTTCATCATGGAGAGAGAGAAATGACCAGTGACAATAAACTTCTTGGTCAGCAGACATCGGTGGGAATACTCCCTGCGCCTCGTGGAGTACCTCAGATGGAAGTCACCTTTGACATCGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGCCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Liv1 5g3  in                        CAAR12512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAG
  5  -1   2       bld Mus1      in                         CABH1031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld BrSp      in                     EC2BBA21BH05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTT
  3   1   2       bld Tad5      in                         XZT56002.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACGCGTCCGGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGG
  3   1   2       bld Te3  5g3  in                         CAAM7579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTG
  3   1   2       bld Hrt1      in                         CAAQ1607.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGT
  5  -1   2       bld Liv1                                  CAAR900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATA
  3   1   2       bld Bone      in                         CBTC728.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT28822.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAGAGAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTTCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTA
  5   1   2       bld Tad5      in                         XZT56002.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Tbd1 5g3  in                         CBXT4543.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAAATGGCCAGTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTTGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAAA
  3   1   2       bld Spl2 5g3  in                        CBSS2208.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Tad5      in                         XZT43640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAATAAACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGG
  3   1   2       bld Tbd1 5g3  in                         CBXT5225.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTACTTCTTGGTCAGTTTACATTGGTTGGAATCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTTGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCATAAAAAAAAAAAAAAA
  5   1   2       bld Tad5      in                          XZT4323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTTCTTGGTAGTTTCATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTGAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 5g3  in                         XZG63889.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAAAAT
  3   1   2       bld Tad5      in                         XZT28822.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGTCAGTTTACATTGGTTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTTCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGCCCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTCCAAATAATAATTAAAAAAAATCCCCTGTC
  3   1   2       bld Tad5      in                         XZT53722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Limb 5g3  in                         CBSU600.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGGAATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTG
  5   1   2       bld Tad5      in                         XZT53722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5 5g3  in                         XZT29756.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCCCCTGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTG
  3   1   2       bld Brn3 5g3  in                         CAAK3353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCCTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAACAAAATCCACTGTC
  3   1   2       bld Tad5      in                         XZT67505.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGCCTCGTGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  3   1   2       bld Mus1 5g3  in                          CABH704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTTTTATTCATGCCCCAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGCCCCGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTTTTTGAAATGGCTTCCAAAAAGATGGCATCTGAAAGAAGCAGCCCTGAAAGTGGCCAACAAAAAGGGGCCCAGAAGGAAGAAAACCAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCCCCATAGTCCTGAGCAAAAATTCCCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCGGTTGTTTTAGTGGGATATTCGTTTTTTCTTTTTTTCTCCAAATAATAATTAAAAAAAATCCCCTGTCC
  3   1   2       bld Tad5      in                         XZT55095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGCCAACAAAAAGAGGCCCAGAAGGAAGAAAACCAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCCCCATAGTCCTGAGCAAAAATTCCCATAAATCTTTTACGGTATTTTTGCAGTACTCTTTATCGTTTGTTGCGGTTGTTTTAGTGGGATATTCGTTTTTTCTTTTTTTCTCCAAATAATAATTAAAAAAAATCCCCTGTCCATTCCTGTGCC
  5   1   2       chi TpA                            TTpA009l05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCG
  3   1   2       bld TbA       out                   TTbA042b11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGATTGAAGTCACTTGGGGCATTGATGCAAATGGAATTGTTCATGTATCTCCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTATGGTGGAGTTAGCAAAGATGACATTGCGAATATGGTAAAGAAAACAGAAAAGTATGCAGAGGAGCATAGAAGGAGAAAGAAACGTGCGGAGGCGGTTTTCAATGTTGAAGCCCCAATTCTTGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCCGCCAGTTGAGGAGTGCAGCAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAAGTCGTGTCACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGATTGGTGAACTTTCCACCAGGCTTCATTTAAAGGATTTGAAATGGCTTACAAAAAGATGGCATTTGAAAGAAGCTGCAGTGAAAGTGGACAACAAAAAGAGGCCCCGAAGGAAGAAAAACAATAAAGTGCGTGGGTGCAAAAGGAGATTGGGAGTTAATTATTCCGAACAGAGAATTTTCCTTAGTCAGGGGCAAAAATTACCAAAAATCTTTTAGGGTATTTTTGCAGTACTCTTTTTTGTTTGTTGCTGATGAAAACGTTGGATATTCGTAAAATAAAAATTATACAAATAAATAATTAAAAAAAATACACTGTCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA071c07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Te1  5g3  in                         CBWN9795.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTGATGCAAATGGAATTGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT7303.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGGTTCATGTATCTGCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCGGTTGTTTTAGTGGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCCCTTC
  5   1   2       bld HdA       in                  THdA024n19.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATCTGCAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTC
  5   1   2       bld Tad5      in                          XZT7303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCTGCAAAGACAAAGGGACAGGCCGTGAACACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCNNANAAAAAAAAAAAAAAAAAAAAAAAAAGGG
  3   1   2       bld Gas7      in                         XZG46775.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAAAAGACAAAGGGACAGGCCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGGGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTTTTCCTGCCCCAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGCCCCGAAAAGACGAAGAAACTGGGGAGGCCATCAGAAATGCTTCATCAACTTTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATTTGAAAGAAGCAGCCCTGAAAGTGGCCAACAAAAAGGGGGCCCGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCCCCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGAAATTTGTTTTTTCTTTTTTTCCCCAAATAATAATTAAAAAAAAATCCCCTGGAAGGG
  3   1   2       bld TpA       out                   TTpA059k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGAAAATAATAACATCAATTCTTTACAAGCCAACACAAAACTTTTTTTTTTTCTGGAATGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA       out                   THdA004c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCGTGAACAACAAATTGTTATTCAGTTTTCTTGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTCTGCAGAGGAGGATAGAAGGAGAAAGGAACGAGTGGAGGCGGTTAACAATGGTGAAGGTTTTATTCAGGACACAGAGTCTCAAATGGAGGAATTTAAGGATCCGCTGCCAGATGATGAGGGCAGCCAACTTAAAGAAGAGATAAGCAAGGTTAAAGAAGTCCTGACATGAAAAGTTGAAGAAAGGGGGGGGACCATCTGAAAAGATTCATTAACTTTCCGGCAGGGTTCACTTAAATTATTTGGAATGGGTTACAAAAAGATGGCCTTTGAAAGAAGCAGCATTTGAAAGTGGACAACAAAAAGAGGATCTCCGAAGGAAGAAAAACAATAAAGTGGGTTGGTGCAAAAGGCGCTTGGGAGTTAAAAATTCAGAATTGGGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATTTTTTACTGTATTTTTGCAGTACTTTTTATCGGAAGGAGACTGTTGTTTTAGTTGGACATTTGTTTTTTCTTTTTTTCTACAAAATAAAAAAAAAAAAAATCCAACTGTCCATTCCTGGAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Tad5      in                          XZT4323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATTGGTATTCAGTCTTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAAGGAGAAAGGAACGTGTGGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGG
  3   1   2       bld Gas1 5g3  in                     NISC_mq21a08.x2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAATTGTTATTCAGTCTTCTGGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAAAG
  3   1   2       bld Tad5      in                           XZT686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGGTGGACTTAGCAAAGATGGCATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAA
  3   1   2       bld HdA       in                    THdA024n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACGTCAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tail 5g3  in                         CBSW5366.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGGACTTAGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGGAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA005h01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAAAGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCCGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATTTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGGCCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCCCGGTCCATTCCTGGAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd0 5g3  in                     NISC_nl13a09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGCCACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCACCAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGCCACGAAAAGACGAAGAAACTGGGGAGCCCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCCCTGAAAGTGGCCACCAAAAAGAGGCCCAGAAGGAAGAAAACCAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCCCCATAGTCCTGAGCAAAAATTCCCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTCCAAATAATAATTAAAAAAAATCCCCTGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd0 FL   in                    IMAGE:5336625.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAATATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCCCTGAAAGTGGACAACAAAAAGAGGGCCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCCCCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCCCTGTCCATTCCTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TpA       in                    TTpA011i12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTTACTGTATTTTTGCCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTTCAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg023m19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATGGTAAAGAATGCAGAAAAGTATGCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGAGGGATTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGGCCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAAT
  3   1   2       bld Tad5      in                          XZT5240.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAGGAACTCTTGACTCGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATTTGAAAGAAGCAGCATTGAAAGTGGACAACAAAAAGAGGTCCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCCCCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTT
  5   1   2       bld Tbd1      out                        CBXT8163.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGAGGAGGATAGAAGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTTGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCTTA
  3   1   2       bld Gas7      in                         XZG46538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGGGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCCCTAAAAAAAGAAAGAAAAAAAG
  5   1   2       bld Gas7      in                         XZG46538.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGAAAGGAACGTGTGGAGGCGGTTAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTaaaaaaagaaagaaaaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld BrSp      in                     EC2BBA20AB03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTATC
  5   1   2       bld BrSp      in                     EC2BBA20AB03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCATGACACAGAGTCAAAAATGGAGGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGGCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1 5g3  in                        CAAR11401.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCCTGACACGAAAAGACGAAGAAACTGGGGAGACCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGG
  3   1   2       bld TpA  5g3  in                   TTpA067d10.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTAAAGAAGGGATAAGCAAGGTAAAAGAACTCCTGCCCCGAAAAGACGAAGAAACTGGGGGGGCCCTCAGAAATGTTTTTTTAACTTTCCAACAGGGTTCACTTAAATTATTTGAAATGGCTTACAAAAAGATGGCTTTTGAAAGAAGCAGCCCTGAAAGTGGGCAACAAAAAGGGGGCCCGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGGGTTAACTTTTCAGAACTGGGAATTCCCCATAGTCCTGGGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCGGTTGTTTTAGTTGGATATTCGTTTTTTTTTTTTTTTTCCAAATAATAATTAAAAAAAATCCCCTGTCCCTTCCTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA                            TTpA010l01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCACTGAAAGTGGACAACAAAAAGAGGACCAGAAGGAAGAAAAACAATAAAGTGCGTTGGTGCAAAAGGCGCTTGGGAGTTAACTATTCAGAACTGAGAATTCACCATAGTCCTGAGCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATTAAAAAAAATCCACTGTCCATTCCTGTG
  3   1   2       bld TbA                             TTbA042b08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAAAAATTACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTATCGTTTGTTGCTGTTGTTTTAGTTGGATATTCGTTTTTTCTTTTTTTCTACAAATAATAATAAAAAAAATCCANCGTCCAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)