Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 98%

 1012070503 Xt7.1-XZT68161.3 - 156 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                    3     5     5     7     9    11    11    14    15    16    18    20    18    21    25    25    25    27    25    27    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    29    29    29    30    30    30    30    30    30    30    30    30    30    31    31    32    32    32    32    32    32    33    33    33    33    33    33    33    33    32    32    32    32    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    33    31    33    32    33    33    34    33    34    31    34    33    34    33    34    32    33    32    33    31    33    30    32    31    33    30    32    30    32    30    32    29    32    29    32    30    33    30    33    29    33    30    33    29    32    28    32    27    32    27    31    23    27    24    28    20    28    21    26    21    27    23    27    22    26    22    26    22    26    22    26    20    23    20    23    20    23    20    22    21    22    22    22    22    22    21    22    22    22    22    22    22    22    21    21    21    21    19    21    20    21    18    21    18    20    18    19    19    19    18    18    19    19    20    20    20    20    20    20    20    20    19    20    20    21    20    21    21    22    21    22    22    22    20    21    21    21    21    24    22    24    22    25    22    23    24    24    25    26    25    26    25    26    25    26    25    26    25    26    25    26    26    28    26    28    27    28    26    27    25    26    25    26    25    25    24    25    23    24    25    26    25    25    24    24    25    25    25    25    24    24    25    25    26    27    26    26    26    27    26    27    26    28    26    27    26    27    26    27    26    27    26    27    26    28    26    28    26    28    26    28    25    28    26    28    29    31    33    36    36    39    38    42    46    48    51    53    56    58    59    62    62    68    66    72    71    74    69    74    69    73    70    73    67    70    70    75    72    79    71    80    73    85    74    85    76    87    80    87    82    87    81    88    82    88    81    87    81    87    82    87    83    88    85    89    83    88    84    88    82    85    81    85    81    86    84    86    84    86    82    84    82    84    83    84    83    85    84    86    84    86    81    84    80    84    80    84    78    84    78    83    81    83    78    82    79    80    77    80    78    80    79    80    78    80    77    80    76    79    75    78    74    78    75    78    76    77    77    77    76    77    73    77    74    77    76    77    76    77    75    77    71    75    70    74    66    74    64    72    62    68    55    65    14    34    12    26     9    14
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGCATTTTCAGATTACAAAGTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAGTGTAACTT
                                                                   SNP                                                                                                                                                                   TC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------C-C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------G
                                               BLH ATG      48    1693                                                                               
                                               BLH MIN      36     245                                                                               
                                               BLH MPR      27     245                                                                               
                                               BLH OVR      48     433                                                                               
                                               EST CLI      13       4                                                                               
                                               ORF LNG      48      67                                                                               
                                                                                                                                                                                PROTEIN --- Ce ---- 1e-056     NP_491942.1 acyl-CoA dehydrogenase (1H361) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 2e-058     NP_648239.1 CG6638-PA [Drosophila melanogaster] --------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Sp ==== 2e-154     XP_782503.2 PREDICTED: similar to Acyl-Coenzyme A dehydrogenase, long chain [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 0          NP_001599.1 acyl-Coenzyme A dehydrogenase, long chain precursor [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Dr ---- 0          NP_957475.1 similar to Acyl Coenzyme A dehydrogenase, long chain [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 0          NP_031407.2 acetyl-Coenzyme A dehydrogenase, long-chain [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 0          NP_001006511.1 similar to Acyl-CoA dehydrogenase, long-chain specific, mitochondrial precursor (LCAD) [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === Xl ==== 0          AAH77524.1 Acadl-prov protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === ?? ==== 0          NP_001086834.1 acyl-Coenzyme A dehydrogenase, long chain [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === Xt ==== 0          CAJ81317.1 acyl-Coenzyme A dehydrogenase, long chain [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT68161.3                                                                                                                TGA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------TAG------------------------------------ATG------------------------------------------------TGA------TGA---TAA------------------------------TAG------------------TGA---------------------------TGA---------TGA------------------------------TGA------------TAG---------------------------------------------ATG------------------------TAG---------------ATG------TAA------------TAA------------TGA---TGA------------------------------TAA---TGA---TGA---TAGTGA---------------------------------------------------------------------------------------------------------------------------------TAGTGA------TAA------------------------------------ATG---------------------------------------------------------------------------TGA------------------TAA------------------------------------------------------------------------------------------TGA------ATG------------------TAG---------TGA------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TGA---TAA---------TGA---TAA---------------------------------TGA---------------TGA------------------------------TGA------ATG------------------------------------------------------------------------------TAG------------------------ATG---------------------------------ATG---------TGATAA---TAA------TAA
                                                                   ORF                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld TbA       in                   TTbA061o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGAACAAACGCCAAGAAAGATGGAAGCGACTGGATACTTAATGGCAGTAAGGTGTTTATTACTAATGGCTGGATGAGTGATGTAGTGATTGTTGTTGCTGTCACAAACCGTGAGGCCCGCACCCCTGCTCATGGCATCAGCCTTTTCCTTGTGGACAACGGAACTAAAGGTTTCGTTAAGGGGAGGAAACTGGAAAAAATCGGCCTGAAGGCGCAGGACACAGCCGAATTGTTTTTTGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGACAGGAAAATAAAGGATTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACT
  5   1   2       bld Tad0                               IMAGE:6984955                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATCAACCGTGAGGCCCGCACCCCTGCTCATGGCATCAGCCTTTTCCTTGTGGACAACGGAACTAAAGGTTTCGTTAAGGGGAGGAAACTGGAAAAAATCGGCCTGAAGGCGCAGGACACAGCCGAATTGTTTTTTGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGACAGGAAAATAAAGGATTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGACGCTGGGGACACATGTGGGAGTACCCACTATTCCAAGTTTATGTATTTTCTCTCGTGCAACCATTCTATGGTGGCACCAGTGAGTGCTTTATGGATCTTATTGCTTGCACATTAGTGCAACATAACTACCCCTTCACCACCTTTTGGAAACACTATCCCCCGAATAATACCCTTATCCCTGTCAAATTCTTGATTTGTCACTCTTGAGATCTCACATGTTTATAAGGTCTTTATTATCCTCACATTGCTAAACACTCGCATCACAATTTATCCTACCAT
  5   1   2       bld Mus1      in                         CABH1771.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTTTCCTTGTGGACAACGGAACTAAAGGTTTCGTTAAGGGGAGGAAACTGGAAAAAATCGGCCTGAAGGCGCAGGACACAGCCGAATTGTTTTTTGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGACAGGAAAATAAAGGATTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTA
  5   1   2       bld Tbd1      in                        CBXT10549.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACTGGAAAAAATCGGCCTGAAGGCGCAGGACACAGCCGAATTGTTTTTTGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGACAGGAAAATAAAGGATTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTT
  5   1   2       bld Ova1      ?                          CABE4446.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACAGCCGAATTGTTTTTTGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGACAGGAAAATAAAGGATTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCCATAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATACTCAAATCTCTGACAGTTCTGCC
  3  -1   2       bld Int1      in                        CAAP12187.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAGGGCGAGAGGGTTTTTTGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGACAGGAAAATAAAGGATTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAA
  5   1   2       bld Ova1      in                         CABE8086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTGAGGATGTACGGCTTCCTGCTGATGCTTTATTGGGACAGGAAAATAAAGGATTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCANACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGC
  5   1   2       bld Eye       in                          CCAX630.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAAATAAAGGATTTTATTACTTAATGGCAGAACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTA
  5   1   2       bld HdA       in                   THdA030a06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAAAAGGATTTTATTACTTAATGGCAGTACTTCCCCAGGAAAGGTTACTGATTGCAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATT
  5   1   2       bld TpA       in                   TTpA028i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATATGGCTCTCGCTAGCTGTGAATTCATGTTTGAGGAAACCAGGAACTATGTGAAACAGAGAAAAGCTTTTGGAAAGACTATTGCACATTTACAGACTGTACAGCACAAGCTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCACGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTT
  5   1   2       bld TbA                            TTbA019m12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGAATTCATGTTTGAGGAAACCCGGAACTATGTGAAACAGATAGAAGCTTTTGGTGATACTATTGCCCATTCACAGACTGTTCAGCACAAGCTAGCTGAATTGAAGACACGCATCTGTATTGGTCGTACCTTCCGGGACAACTGTCTCCAG
  5   1   2       bld Mus1      in                         CABH3133.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGCTGAGTTGAAGACACAGATCTGTATTGGTCGTACCTTCCTGGACAACTGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAG
  5   1   2       bld TpA       in                   TTpA058g19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATTGGTCGTACCTTCCTGGACAACTGGTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAATATAAGTATTTAAAATATAATAATCTATTCTAACTATTATATGCTCTTTCTAGC
  5   1   2       bld TpA       in                   TTpA058h19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATTGGTCGTACCTTCCTGGACAACTGNTCTCCAGCTTCATGCAGAGAAACGTTTAGACTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTC
  5   1   2       bld Tad5      in                         XZT68161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCGCCACAGCTTCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCA
  5   1   2       bld Egg       in                   TEgg027e18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCATGGCAAAATACTGGGCATCTGATCTGCAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTA
  5   1   2       bld Mus1      in                         CABH7975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAATTCTGTGGCAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCA
  5   1   2       bld Te5       in                         CAAO9984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACTCAGTGTGTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTAGCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTTAAAATATAATAATCTATTCTAAACTATATATG
  5   1   2       bld Tad5      in                         XZT54518.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCAACTTCATGGAGGCTGGGGATACATGTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAAACTATATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAAGTACATACAGTATGT
  5   1   2       bld Tad5      in                         XZT21822.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGGGAGTACCCAATAGCAAAAGCTTATGTAGATTCTCGCGTTCAACCAATCTATGGTGGCACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAANAATATAAGTATT
  5   1   2       bld TbA       in                   TTbA070j18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACCATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCANATAGGGTAAAACCACCAGGGAAGTTACATACANGTATGTGTTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTANTATAATAATAATATTAAG
  5   1   2       bld Mus1      in                         CABH4557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCCTAGCAGATTTCAGCACATGTGGATATTTTTCAGACTGCATTTTCTATA
  5   1   2       bld Mus1      in                         CABH8080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAATGAGATCATGAAGGAACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAAGATCAAGCACATGTGGATA
  5   1   2       bld TpA                            TTpA037h14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACTTATTGCCAGAGATATTGTAAAAGAAAAGTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAACTAT
  3  -1   2       bld Ovi1      in                         CABI9594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGCTAGCCTTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACGGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATNTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGT
  5   1   2       bld Egg       in                   TEgg031g10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCT
  5   1   2       bld Egg                            TEgg097o15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCACTGAAATTCTGTTCTTCAACTCTGCCTTAATGTTTTCATGTGCCATTTTTCCACATTTTCATATAGGTTTCTTAATTTGTTGAGCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACC
  5   1   2       bld TpA                            TTpA024k10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGGGGCCCGGGGAAAACATGGNTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATC
  5   1   2       bld Tad5      in                         XZT60277.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAAATGATCATAAACACATGGTTCCTTTTTGCGGTTACGGTTGTAGAAAAAGAATCTCAAATCCTGACAGTTTGCCAGTGGACTGGGTGGCTTTTGAGTTTCATTTTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTT
  3  -1   2       bld Hrt1      in                        CAAQ10834.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCT
  5   1   2       bld Tad5      in                         XZT53244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAATTCTTTTCTTTGTAAATCTCTCTGGTAACTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGNGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAG
  5   1   2       bld Bone      in                        CBTC6875.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAAGGATTAAAGTCTAGATCTCACTCAAACTAAGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAATACTTTTTCATTAGTGTAACTTATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCT
  5   1   2       bld Fat1      in                          CABC959.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGGAGGCAGCAGCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAGGTTTC
  5   1   2       bld Tad5      in                         XZT22107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGCAAGGAATATTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGGAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGT
  5   1   2       bld Liv1      in                         CAAR3065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCGATTCGTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGT
  5   1   2       bld Tad5      in                         XZT69675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTG
  5   1   2       chi Egg                            TEgg052n14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCATGCCAGAGGAAATTGTTGCTAAACCATAGCAATCCTTTAACAGCATGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGGGAATTAATGAAATATTTAAGTATGATGTTGAAGTAGTGAGAAAGTAGGGGGGTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTATTGATTTTTTTTGTTTTTTTTTTTTAAATTTTAATTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCT
  5   1   2       bld HdA       in                  THdA031k02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAGCATGGTTCTTTTAAATTGAAAGGTATTAACAAGATATTAGCTGAGGCTGAAATAAAGTGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGTGGGGTTTGTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTG
  5   1   2       bld Bone      in                        CBTC3507.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGACATCTACACTGAAATACTTTAAGTATGATGTTGACAGTAGTGAGAAAGTCAGTGGTTGGTCTTTTTGTGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAATACTTTTTCATTAGTGTAACTTATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCAAAATCAGCTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAG
  3   1   2       bld Neu0      in                       IMAGE:6992260                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTCAGTGGTTGGTCTTTATTGGTGTGTTTGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTGGGTATTTGCCAGTGTTTCAGCTGGCAGGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAGGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTGTAAATGATACACTTAATGGAAA
  3   1   2       bld Mus1      in                         CABH8080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTGTAAATGATAACATT
  3   1   2       bld Ski1      in                         CABJ1700.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTT
  5   1   2       bld Tad5      in                         XZT29965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGTCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTTCATAAAGTAAGTG
  5  -1   2       bld Int1      in                        CAAP11626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCGGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTNTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTT
  3   1   2       bld Int1      in                        CAAP13193.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAAGAATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAAC
  5  -1   2       bld Int1      in                        CAAP12187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGAATTATTTAACTTTAGTTCTGCAGCTTTCAGTTGGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAAT
  5  -1   2       bld Fat1      in                        CABC10936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAATTATTTACTTTTAGTTCTGCAGCCTTTCAGTTGAGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAAAAAAA
  3   1   2      seed Tad5      in                         XZT68161.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTATTTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGT
  3   1   2       bld Mus1      in                         CABH3133.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAACTTTAGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAA
  3   1   2       bld Mus1      in                         CABH4557.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTTCTGCAGCCTTTCAGTTTGGTATTGCCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Int1      in                         CAAP7330.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTCTGCAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAAGCCTCTCGCCCT
  5  -1   2       bld Hrt1      in                        CAAQ10834.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGCCTTTCAGTTTGGTATTGCCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAA
  3   1   2       bld Ova1      in                          CABE724.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCCTTTCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Mus1      in                         CABH7975.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCCTTTCAGTTTGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld TbA  5g3  in                    TTbA077p23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATATTAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TpA                             TTpA017c06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCCAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATCATTTTTCAATCAAGACAGTGAACACTGAAAAAACCAAACCCACAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA035l02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTTTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATCGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld HdA  5g3  in                    THdA049n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAAGAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tad5      in                         XZT53244.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTGGTATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAAC
  3   1   2       bld Fat1      in                          CABC959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTTGCCAGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTCNTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTT
  3   1   2       bld Lun1      in                        CABD12282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Lun1      in                         CABD7902.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGGTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Tad5      in                         XZT69675.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGTTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTT
  3   1   2       bld Mus1      in                         CABH1771.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATT
  3   1   2       bld Ovi1      in                         CABI2481.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTCAGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  5   1   2       chi TpA       out                  TTpA035g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTG
  3   1   2       bld Ova1      in                         CABE2802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Ova1      in                         CABE8086.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Mus1 5g3  in                        CABH11431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld TpA       in                    TTpA028i09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGGCAGCCTGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCCCCCTATAGGGAAGCTAGTGATTTTTGAATATAAAAATATTTTTGAGTATAAAGGTTTTTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTTTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTTTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTGAAGGTGACCCCATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FL   in                    TEgg069o04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGGAACAATGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA042e12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCTCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Mus1      in                         CABH8483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGGTAGATTCCAGGGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Mus1      in                         CABH5412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGTAGATACCAGGGCTAGTGAAAAATATAAGTATTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGTATAGTT
  3   1   2       bld Brn3 5g3  in                        CAAK12919.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Tad5      in                         XZT54518.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTAGTGAAAAATATAAGTATTAAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Liv1      in                         CAAR3065.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Ova1      in                        CABE12045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAGGGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld TpA       in                    TTpA058g19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAGGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCCCACTATAGGGAAGCTAGTGATTTTTGAATATAAAAATATTTTTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTTTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCCCCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGCCCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAGGGACCAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA031k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGAAAAATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGGAACAATGAAAAAAAAAAAAAAAAAAGCG
  5  -1   2       bld Ovi1      in                         CABI9594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGTATAGTT
  3   1   2       bld Tad5      in                         XZT60277.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Te4  5g3  in                         CAAN7457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGTATAGTT
  3   1   2       bld Hrt1      in                         CAAQ2213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATATAAGTATTAAAATTTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGTATAGTT
  3   1   2       bld Mus1      in                         CABH4406.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAAGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCCCCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGTATAGTT
  3   1   2       bld TpA  5g3  in                   TTpA076j20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTATTTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGGAACAATGAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA058h19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAAAATTATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATCCAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTTTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCCCCCTATAGGGAAGCTAGTGATTTTTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGACCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCCCCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGCCCTCTGTGAAATCCATGTTTTGTAAATGATACCATTAATTGGAATAATTTTTCAATAAAGTAGGGACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4  5g3  in                         CAAN3439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATAATAATCTATTCTAACTATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld BrSp 5g3  in                     EC2BBA32AC02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATTATATGCTCTTTCTAGCAAATAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTCCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTG
  3   1   2       bld Eye       in                          CCAX630.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTATATGCTCTTTCTAGCAAATAGGGTAAACCCCCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Te4       in                         CAAN9878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAANTAGGGTAAACCACCAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTGTATAGT
  3   1   2       bld Tad5      in                         XZT67558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAAC
  3   1   2       bld Gas7 5g3  in                         XZG37013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGTTAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAA
  3   1   2       bld Brn3 5g3  in                          CAAK501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Bone      in                        CBTC6875.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGAAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAATACTTTTTCATTAGTGTAACTTATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACTTTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Tad5      in                         XZT21822.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Bone      in                        CBTC3507.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAATACTTTTTCATTAGTGTAACTTATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACTTTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATG
  3   1   2       bld Egg       in                    TEgg027e18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATNAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA070j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAAGAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TbA       in                    TTbA061o10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACATACAGTATGTGTTGTGGCATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTTTGAATATAAAAATATTTTTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAATTTCCGCTTGGCTTCTGGTCAACTCAGGGGCTGTAAAAATAAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCT
  3   1   2       bld Egg       in                    TEgg031g10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTATGTGTTGTGGCATTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATNAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGTATAGTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT29965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATTTTCAGATTACAAAGGGAAAGACTTTTTCATTAGGGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTTTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTTTTGGCTTGAAAACTATTTTTGGGGGGGCTGAGAAACCCCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCCCCCTATAGGGAAGCTAGTGATTTTTGAATATAAAAATATTTTTGAGTATAAAGGTTTTTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGGGTAACCATGCAGTATTTCAATCCCCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTTTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGGGGCCCATGG
  3   1   2       bld Te1  5g3  in                         CBWN8035.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTTCAGATTACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACTTTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGTATAGTTAAAAAAAAAAAAAAA
  5   1   2       bld Spl2      in                        CBSS5564.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGGACGCGCTGGGCTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTNCACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAATGATAACATTAATTG
  3   1   2       bld Int1      in                         CAAP5931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAAGTGAAAGACTTTTTCCTTAGGGGAACTTATAATAATAATAATATTAAGAAAAACTCCTAGCCAGATTCAAGCCCATGGGGGTATTTTTCCGGCTGCATTTTTTATATTGGAACTGGGGCTAAATATGGAAGGATGCCCGTCCTGTTAGTTTTTGGCTTGAAAACTATTTTTGGGGGGGGTGGGAAACCCCCGTAATAGGTCCTACAGGCAGTTTGCATTACAATCAACTGGGGGGGGCAGGGGGGGTTTTGGGTTAAGATATACTGGCAGAAAAAAGCTCCCGGACAATTTTTTTTGGCTCCAAATTCAGCTTGTTTTAGAAGCTTCCCCCTATAGGGGAGGTAGGGGTTTTTGAATATAAAAATATTTTTGGGTATAAAGGTTTTTTTTGGGGGTCCGGGAAAAATTGTTTTGACTGTTAAGGAACATTTGAGCCTTAAAATTTTTTTCTTTGGGTAAAGCATGGGGAACCCTGCAGTTTTTCAATCCCCCGTTAGGGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGGTTTTGGTCAACTCAGGGGGGTAGAAAGAATTTGTTTTTGTTGTCCCAATGATAGTAAACCAAATCCTGGCCTTTGGGAAAACCCTGTTTTGTAAAAGATAACCTTAATTGGGATAATTTTTCCATAAAGTAAG
  3   1   2       bld Mus1      in                         CABH6128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGCCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAAAAAA
  5   1   2       bld Mus1      in                         CABH6128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAAGTGAAAGACTTTTTCATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGCCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAAAAAA
  3   1   2       bld Te5       in                         CAAO9984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATCTGTTGTGTTTATTAAAAAACATTTGTATAGTT
  3   1   2       bld Spl2      in                        CBSS5564.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGTGTAACTTATAATAATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGTGTTGTGTTTATTAAAAAACATTTGTATAGT
  5   1   2       bld Tad5                                 XZT18108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATAATAATATTAAGAATAACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT10549.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACTCCTAGCAAGATTCAAGCACATGTGGATATTTTTCAGACTGCATTTTCTATATGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACTTTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGAAAAAAAAAAAAAAA
  3   1   2       bld Mus1      in                         CABH8512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTATTTTGGAACTGGGCCTAAATATGGAAGGATGCCAGTCCTGTTAGTTTTTGGCTTGAAAACTATTTTTGGGGGGGCTGGGAAACCCCAGTATTAGCTCCTACAGGCAGTTTGCATTCCAATCACCTGGGGGTGGCAGGGGTGGTTTTGGGTTAAGATATCCGGGCAGAAAAATGCTCCCGTACAATTTTTTTTGGCTCCAAATTCACCTTGTTATAGAAGCTTCCCCCTTTAGGGAAGCTAGTGTTTTCTGAATATAAAAATTTTTTTGGGTATAAAGGTTTTTTTTGTGGGTCAGGAAAATATTTTTTTGCCTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGGGTAATGCATGGGTACCCATGCGGTTTTTCAATCCCCAGTTAGTGCCGGCAGGTTTTTTAAACCAAGGTTCCCCTTGGCTTTTGGTCAACTCAGGGCTGTGGAAAGAATTTGTTTTTGTTGTCCAAATGATGGTAAACCAAATCC
  5   1   2       bld Bone                                CBTC7402.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGGAACTGTGACTAAATATGGAAGGATGCCAGTCCTGTTAGTTCTTGGCTTGAAAACTATTTTTGGGGGGACTGAGAAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACTTTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGACAAAGACAAATCTCAAAAAT
  3   1   2       bld HdA       in                    THdA030a06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAATATGGAAGGATGCCCGTCCCGTTAGTTTTTGGCTTGAAAAATATTTTTGGGGGGGGTGGGAAACACCCGTAATAGTTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGGGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTTTTTGGGTCCAAATTCAGCTTGTTATAGAAGCTTCCCCCTATAGGGAAGGTAGGGATTTTTGAATATAAAAATATTTTTGGGTATAAAGGTTTTTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATTTTTTTTTTTGTGTAATGCATGGGTAACCATGCAGTTTTTCAATCCCCAGTTAGGGCCTGCAGGTATTTTAAACCAAGGTTCCGCTTGGGTTTTGGTCAAATCAGGGGTGTAGAAAGAATTTGTTTTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTTTGGGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGGTGGCCCATGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Tad5      in                         XZT22107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACACCAGTAATAGCTCCTACAGGCAGTTTGCATTACAATCAGCTGGAGGTGGCAGGGGTGGTTTTGGGTTAAGATATACTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCCCCCTATAGGGAAGCTAGTGATTTTTGAATATAAAAATATTTTTGAGTATAAAGGTTTTTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTTTGTGTAATGCATGGGTAACCATGCAGTATTTCAATCCCCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTTTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGT
  3   1   2       bld HeRe                             EC2CAA37DF09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGATATAGTGGCAGAAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACTTTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAA
  5   1   2       bld Sto1                                 CABG7849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAATGCTCACGTACAATTTTATTTGGCTCCAAATTCAGCTTGTTATAGAAGCTTCACACTATAGGGAAGCTAGTGATTTCTGAATATAAAAATATTTCTGAGTATAAAGGTTTCTTTTGTGGGTCAGGATAATATTGTTTTGACTGTTAAGTAACATTTGAGCCTTAAAATCTTTCTCTCTGTGTAATGCATGAGTAACCATGCAGTATCTCAATCACCAGTTAGTGCCTGCAGGTATATTAAACCAAGGTTCCGCTTGGCTTCTGGTCAACTCAGGGCTGTAGAATGAATTTGTTCTTGTTGTCCAAATGATAGTAAACCAAATCCTGACCTCTGTGAAATCCATGTTTTGTAAATGATAACATTAATTGGAATAATTTTTCAATAAAGTAAGTGAACAATGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

In case of problems mail me! (