Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 82%

 1012070511 Xt7.1-TGas088n10.3 - 178 ESTs
                                                                       .......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas088n10.3                                                          GAAGCGGGGGAAGGTTGCTGTGGGAGGATCAGGAAGCCGGGGCACAGATCTGAAGGAGGGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222034                                                                GGGGAAGGTTGCTGTGGGAGGATCAGGAAGCCGGGGCACAGATCTGAAGGAGGGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                               3     3     3     3     3     4     3     5     5     6     8     8     8     9    14    16    15    19    15    21    23    29    34    37    42    44    47    52    56    60    62    67    67    67    67    67    67    67    65    67    66    67    68    68    68    68    69    69    68    69    68    69    68    69    68    70    68    71    71    73    71    73    71    73    71    73    71    73    72    74    72    74    73    75    73    75    73    74    73    74    73    74    73    74    73    74    73    74    73    74    74    75    74    75    74    75    76    76    77    77    77    77    77    77    77    78    77    78    75    78    73    77    73    77    71    77    69    75    69    76    68    76    66    75    64    75    64    75    63    74    62    74    62    74    60    74    60    76    59    78    58    77    58    76    55    75    52    72    48    70    51    69    47    66    42    60    38    56    39    56    34    51    35    52    35    54    35    53    39    58    44    63    50    61    53    63    58    68    59    71    72    81    74    81    76    82    76    83    81    88    87    91    92    97    93    97    91    96    94    98    97   101    97   101    97   101    97   101    97   101    97   100    98   100    98   100    98   100    98   100    98   100    97    99    97    99    96    98    96    98    96    97    97    97    97    97    95    95    95    95    95    95    94    95    86    93    93    93    93    93    93    93    92    93    93    93    91    91    90    90    90    90    88    90    88    89    89    89    87    89    88    88    86    87    87    87    85    86    83    84    83    83    81    82    81    82    81    82    79    82    81    81    81    81    79    81    80    81    78    80    74    79    75    77    64    75    18    25    13    15
                                                                   SNP                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------T
                                               BLH ATG     128     180                                                          
                                               BLH MIN     128      62                                                          
                                               BLH MPR      83      62                                                          
                                               BLH OVR     128      33                                                          
                                               CDS MIN     128      19                                                          
                                               EST CLI     114      19                                                          
                                               ORF LNG     128       2                                                          
                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 8e-016     NP_650287.3 CG9796-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                   PREDICTED - Ce ---- 6e-023     NP_495668.1 predicted CDS, lysosomal thiol reductase IP30 family member (2I224)[Caenorhabditis elegans] ------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Gg ==== 8e-037     XP_418246.1 PREDICTED: similar to Gamma-interferon inducible lysosomal thiol reductase precursor (Gamma-interferon-inducible protein IP-30) [Gallus gallus] =============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Sp ==== 8e-049     XP_001203858.1 PREDICTED: similar to interferon gamma-inducible protein 30, partial [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - ?? ---- 1e-050     XP_693944.1 PREDICTED: similar to Interferon gamma inducible protein 30 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 2e-051     NP_075552.1 interferon gamma inducible protein 30; lysosomal thiol reductase IP30 precursor;lysosomal thio reductase IP30 precursor [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 1e-056     NP_006323.2 interferon, gamma-inducible protein 30 preproprotein; gamma-interferon-induciblelysosomal thiol reductase [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Br ---- 1e-064     AAQ83892.1 interferon gamma-inducible protein 30 [Branchiostoma belcheri tsingtaunese] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                        PROTEIN --- Dr ---- 4e-069     NP_001006057.1 interferon gamma inducible protein 30 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 3e-155     NP_001017196.1 interferon, gamma-inducible protein 30 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas088n10.3                                                                                                            TGA---------------------------------------------TGA---TAA---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG------------TAA------------------------------------------------ATG------------------------------------------------TAG------------------------------------------------------------TGA------------------TGAATG------------TAA------------TAAATG------------ATG---------------------------TGA------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------TAG------------------------------TGA------------------------------------------------------------------------------------------TAA---------------------------------------------------TAG------------------------------------------------TAA---ATG------------------------TAA------------------------------TAA------ATG------------------ATG------TGA---TAA------------------------------ATG---------TAATAATAG------TAA
                                                                   ORF                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  0   1   1           Egg  FL                     TEgg021j16.FL-Sanger                                                                                                                                                                                CCGACGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAGAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGTGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTTAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACCGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATTCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g                        TEgg095c23.p1kSP6 TTAAACTTTGCTTGAGTCTTTGGTTTTGTGACGGGGGATCCGGATCTCTGATCAAGAGAAGCGGGGGAAGGATGCTGTGGGATGATCATGAAGCCGGGGCACAGATCTGAAGGAGGGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGACGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGAGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCTAGGAATGCCATGCGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTAGAACCAGACTATTCACATAGATTTATTCTATGAAAGTCTCTGTGGAGGTAGTATAGGTTTCCTTGTCCGGCAACTTTTTCCATCATGGCTGATGCTCGCTGAAATGATCTGTGTGACATTACTTCCTTATGGGAATGCTCTGGAAACAAACATCACTGGTAAATGG
  5   1   2   12  bld Gas7 5g3  in                         XZG44285.5p .....................GGTTTTGTGACGGGGGATCCGGATCACTGATCAGGAGAAGCGGGGGAAGGTTGCTGTGGGAGGATCAGGAAGCCGGGGCACAGATCTGAAGGAGGGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGTCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCCAAGCCAGAAACCTGCTTGCACAGTGAA
  5   1   2       bld Egg  5g3  in                   TEgg049p06.p1kSP6                                                      AGGAGAAGCGGGGGAAGGTTGCTGTGGGAGGATCAGGAAGCCGGGGCACAGATCTGAAGGAGGGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCATGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTG
  5   1   2       bld Gas  5g                        TGas030m09.p1kSP6                                                                            CTGTGGGAGGATCAGGAAGCCGGGGCACAGATCTGAAGGAGGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGACGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAA
  5   1   2       chi Gas7 5g3  in                         XZG47083.5p                                                                                            GTCCTCCTCACAGATCTGAAGGAGGGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCCCAAACTGTGACTGAATGGCTATGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGNGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGC
  5   1   2       bld Gas  5g3  in                   TGas088n10.p1kSP6                                                                                                       AGATCTGAAGGAGGGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGG
  5   1   2       bld Te5                                  CAAO7741.5p                                                                                                                    GGACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTAT
  5   1   2       bld TbA  5g3  in                   TTbA072n13.p1kSP6                                                                                                                      ACTTTTTATTTAGTCATGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCAGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAANACTATTCCAACA
  5   1   2       bld In66 5x3                        IMAGE:8966663.5p                                                                                                                              AAAGTCATTGTTAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGACCCTGCTTGCACAGTGAATACACCATTAAAAGGATGTTCTCTTGCTAACTGATTACTCCTGAATTGCTCCTACGAAACTATTCAAACCAGGCAATGACTTTCGAACTACGGGTGTTTGTTTCTTTTCTTTCTTTCCAATCCTATGACTCACAGTTACTAATTAGTTGACTTGCATACATAAGCCTTCCTAAGGTCAGGGGAACTTAAGGGTATGTTCCTCGAACTGACAGTCA
  5   1   2       bld TbA  5g3  in                   TTbA031l11.p1kSP6                                                                                                                                         CCCGGGGACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCAGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGNGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCCTACAGAAACTATTCCAACACCAGNGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTTCAC
  5   1   2   10  bld Ova1 5g3  in                        CABE10023.5p ........................................................................................................................................TAATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCCTAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCA
  5   1   2       bld TpA  5g3  in                   TTpA061d08.p1kSP6                                                                                                                                          AATAGCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGACGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAGAGGGATGTTCTCTGCCTAANCTGAATTACTCCTGAATTGCTCCTAC
  5   1   2       bld In62 5g                         IMAGE:8957009.5p                                                                                                                                          CTTTCCTTTTTATGAAGAATTAACAACATAAAAATAATCCCGGCGAACATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAACCAAAGGACTCAGTCCTCTCACAATTATGTGCCCTGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAGTTCTCTCTTTACTGTTGTGACCATACATGACGAGCAGACCTGCTGCACAGTGGATACCATAAAAATGTTTCTCTGCCTAACTGATATCTGATGTCCTACGAAACATTCAATCCAGGCAATTACTTCGACATAC
  5   1   2       bld AbdN 5g                            IMAGE:7023076                                                                                                                                              GCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGANAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAANAGGACCAAAGCCCAGACCCCTGCTTGCACAGTGGAAATAACACCATTAAAAAAGGGATGTTTCTCTGNCCTAAAACTGAAATTACCTCCTGGAATTGCTTCCCTACAGAAAAACTATTTTCCAACACCCAGGGGCAAAATGGTAACTTTTTTCAAGACC
  5   1   2   12  bld Tad5 5g3  in                         XZT48782.5p .............................................................................................................................................GCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCANAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACANGAAACTATT
  5   1   2   10  bld Spl2 5g3  in                       CBSS10409.fwd .............................................................................................................................................GCAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGT
  5   1   2       bld Lun1      in                         CABD6484.5p                                                                                                                                               CAACTTGAAGCACTGATTTTAATTCCCAAACAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCAT
  5   1   2       bld In63 5g                         IMAGE:8957818.5p                                                                                                                                               ACGGACTTTTATTTTGAAGGTCCCATTAAATAAAAAATATCCCCTGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAGCCAGAACCCTGCTTGCACAGTGAATAACACATTAAAAGGGATGTTCTCTGCTAACTGATACTCTGATGCTCTACGAAACTATTCCAACCAGCATGTACTTTCGACTACGGGTGTTTTGTTTCCTTTTTCTTTTTCTTTCACTTCTAAT
  5   1   2       bld In60 5x3                        IMAGE:8949161.5p                                                                                                                                                      CTTTTTTTCACTACCTTGATCTAACACCTCAAATTCGTCCGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTTGTTTGTGACACCATACTAAGGACCAAGCCAGAACCCTGCTTGCATAGTGAAATAACACCATTAAAAGGATGTTCTCTGCCTAAATTGAATTTACTCCTGAATTGCTCCTACGTAAACTATTCTAAACCCAGGACATGTACTTTTCGACCTACCGTGTGTTTTTTGTTTACTATTTCTATTCTTTTCCCATCCTTAGTAACTTTCACGATAACTATAATATTGGGTTTGC
  5   1   2   10  bld Spl2 5g3  in                        CBSS3137.fwd ................................................................................................................................................................CATCGATTCGAATTCCCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGG
  5   1   2       bld Egg  5g                        TEgg118l05.p1kSP6                                                                                                                                                                   CCGGGGCCCGGGGCCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTG
  5   1   2       bld Egg  5g                        TEgg119l05.p1kSP6                                                                                                                                                                         CCCGGGGCCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATT
  5   1   2   10  bld Thy1 5g3  in                       CBST13190.fwd ...........................................................................................................................................................................CAACCGAGAGTACCATGAAGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAAGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACAAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGTAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTG
  5   1   2   12  bld Gas7 5g3  in                         XZG63635.5p ............................................................................................................................................................................CAACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAGAGGGATGTTCTCTGCCCTAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCCAC
  5   1   2   10  bld Spl2 5g3  in                        CBSS9667.fwd ............................................................................................................................................................................GTGACCCACGCGTCGGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAAC
  5   1   2   12  bld Gas7 5g3  in                         XZG47443.5p .............................................................................................................................................................................AACCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACT
  5   1   2   10  bld Spl2 5g3  in                        CBSS1406.fwd ...............................................................................................................................................................................CCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGTCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAG
  5   1   2   10  bld Tail 5g3  in                         CBSW1241.b1 ...............................................................................................................................................................................CCGGCGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAAGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTCGAGGTTTTCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGTCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATCTACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGATACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAGAGGGATGTTCTCTGCCTAAACTGAATTACTCC
  5   1   2       bld Egg  FL   in                   TEgg021j16.p1kSP6                                                                                                                                                                                 CGACGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACA
  5   1   2       bld Neu  5g                        TNeu009a13.p1kSP6                                                                                                                                                                                    CGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATC
  5   1   2   10  bld Spl2 5g3  in                        CBSS9164.fwd ...................................................................................................................................................................................GGTACCATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAAC
  5   1   2       bld In63                            IMAGE:8962125.5p                                                                                                                                                                                          AGTGTAGTACCTTGCTTCTGCTCTTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAAGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCATGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAGCACAGCTCAAAGTCTCTCTTTATCTTGTTGTGACCATACAAGACAAGCAGACCTGCTGCACAGTGATACACATAAAAGGATGTCCTGCTACTGATACTCTGATGCTCTACGAACTATCACCAGCATGAACTTCGACTACGGTTGTCCTTTCTTCTTCATCTTGACTTCAAGATACATAATTGTGACT
  5   1   2   10  bld Spl2 5g3  in                        CBSS1705.fwd .........................................................................................................................................................................................ATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGAT
  5   1   2   10  bld Eye  5g3  in                         CCAX9246.b1 .........................................................................................................................................................................................ATGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGAT
  5   1   2       bld Spl2      in                        CBSS7860.fwd                                                                                                                                                                                           TGAGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCT
  5   1   2       bld AbdN                               IMAGE:7021408                                                                                                                                                                                             TTGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCTTTGATGGGATGCACCCTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTTGGGACAACTTCAAAGGAACCAAAGCCCAAAACCCCTGCTTTGCACCAGTGGAAAATAACACCCCTTTAAAAAAAGGGGAATGTTTTCTCTGGCCCTTAAAACTGGAAATTTACTCCCCTGGAAATTTGCTTCCCCCTCCCAGAGAAAAAACTCTATTTCCCCCACACCCTCCCGAGGGGGCGCAAAAGAGGGGTATCATTTTTTTTTTCAAAAAAAACATAT
  5   1   2       bld TpA       in                   TTpA024k03.p1kSP6                                                                                                                                                                                             AGGTGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAGAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTAT
  5   1   2       bld Gas                            TGas119c05.p1kSP6                                                                                                                                                                                                TGTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCT
  5   1   2       bld AbdN                               IMAGE:7023751                                                                                                                                                                                                 GTTACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAATANTCCACACCAGGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTTGTTTCCCTTTTTTCTTTTCCTTTTCCAATTTCTTAAGTACTTTCAACAGTATAACTAATATTTTGGGTTTGCACCCTTGGCATTTCCACTAGAGGGCTTTTCCTTCTTAAAGGGNTTTCCAGGGTGGAGACCTTTTTAAAT
  5   1   2       bld Ova1      in                         CABE2187.5p                                                                                                                                                                                                   TACCTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCC
  5   1   2       bld AbdN      in                       IMAGE:7007394                                                                                                                                                                                                     CCTGCTTCTGCTCTGCGCAATGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTAACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGGCAAATGTACTTTTCAGACTAACCCGGGTGTTTTTTGTTTTTCCCTT
  5   1   2       bld Ova1      in                        CABE11194.5p                                                                                                                                                                                                      CTGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTA
  5   1   2       bld Gas7      in                          XZG6909.5p                                                                                                                                                                                                       GGCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTGACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGAGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAGAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGA
  5   1   2       bld Abd0      in                       IMAGE:6999383                                                                                                                                                                                                        GCTTCTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACATCATTAAAAAGGGATGTTCTCT
  5   1   2       bld AbdN                               IMAGE:7023671                                                                                                                                                                                                            CTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCCAGACCCTGCTTGCACAGTGAAATAACACCCATAAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAAACTATTCCAACACCAGGGCCAAATGTACTTTTTCAGACTAAACGNGGTGTTTTTTGGTTTTCCCCTTTTTTTCCTTTTTCCTTTTCCCAATTCCCTTAAGGTACTTTTCA
  5   1   2       bld Spl2      in                        CBSS3670.fwd                                                                                                                                                                                                            CTGCTCTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAGAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACA
  5   1   2       bld AbdN                               IMAGE:7024211                                                                                                                                                                                                                 CTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGGCTTGCACAGTGAAATAACACCATTTAAAAGGGATGTTNCTCTGCCTAAACTGAATTTACTCTGAATTGCTCCTACAGAAAACTATTTCAACACCCAGGGCAAAATGTACTTTTCAGACTAACCCGTGTGTTTTTTGGTTTTCCCCCTTTTTTCCTTTTTCCTTTTCC
  3  -1   2       bld Liv1      in                        CAAR10134.3p                                                                                                                                                                                                                 CTATAGGGCGAGAGGTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCTTTTTTCTTT
  5   1   2       bld Ova1      in                         CABE4561.5p                                                                                                                                                                                                                 CTGCGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACC
  5   1   2       bld In62                            IMAGE:8954298.5p                                                                                                                                                                                                                  GCGCCTGTGGGGGCTGCCTCCCAGCCCGCGTTTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTCTCTCTTAACTTGTTGTGACACATACAAAGGACAAAGCAGACCCTGCTTGCACAGTGAATACACATTAAAAGGATGTCTCTGCTAACTGATTACTCTGATGCTCTACAGAAACTATCACACAGGCAATGACTTTCAACTACGTGGTTTGTTCCTTTTCTTTCTTCCATCTAGACTCAAGATACTATTTGGTGACTGATCCAAGCTTCTCAAGGTGAGGGACTATGGGTGTCTGATGATGCACGATAGCCACATCATGTATGTTAGAGACAGATGGGTATGATAGATGGTCGCTTGCTTTAATCCTCAACGGCCCGCGA
  5   1   2       bld Liv1      in                         CAAR6127.5p                                                                                                                                                                                                                    CGCTGTGGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGAC
  5   1   2       bld Spl1      in                         CABK2961.5p                                                                                                                                                                                                                      CATCGATTCGCTGCCTCCCAGCCCGTGTGTACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTCCCTTTTTTCTT
  5   1   2       bld Tail      in                        CBSW12242.b1                                                                                                                                                                                                                          GGGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATT
  5   1   2       bld Hrt1      in                        CAAQ12878.5p                                                                                                                                                                                                                           GGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGGCAATGTACTTTTCAGACTAACC
  5   1   2       bld Spl1      in                         CABK5624.5p                                                                                                                                                                                                                           GGGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTA
  5   1   2       bld AbdN                               IMAGE:7022422                                                                                                                                                                                                                            GGGCTGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGGACCAAAGCCAGGAACCCTGCTTTGCACCAGTGGAAATAACCACCCATTATAAAAGGGGATTGTTTCTCTTGCCCTAAACCTGAAATTACTCCCTTGAATTGCCTCCTACAGAAAAACTAATTTCCAACAACCCAGGGCCAAAAGTGACTTTTTTCACAAACTAAACCGGGGGGGGTTTTTTTGGTTTTCCCCCTTTATTTCCCTTTTTTCCTTTTTCCCCAAATTGCCTTTATGGGGGAACTTTTCCAACAGGGGTGTTAAACTTCTTTTTC
  5   1   2       bld Spl1      in                         CABK7010.5p                                                                                                                                                                                                                            CATCGATTCGCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATTGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCA
  5   1   2       bld Abd0                               IMAGE:7002789                                                                                                                                                                                                                                TGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTNNGCTAACTGAATTACTCCTGAATTGCTCCTA
  5   1   2       bld Spl2      in                        CBSS6762.fwd                                                                                                                                                                                                                                TGCCTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAG
  5   1   2       bld Spl1      in                         CABK5536.5p                                                                                                                                                                                                                                  CATCGATTCGCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTA
  5   1   2       bld Ovi1      in                        CABI11548.5p                                                                                                                                                                                                                                   CTCCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTATGTTTTCCCTTTTTTCTTTTTCTTTT
  5   1   2       bld Spl1      in                         CABK3768.5p                                                                                                                                                                                                                                     CCCAGCCCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCATT
  5   1   2       bld Ski1      in                         CABJ4310.5p                                                                                                                                                                                                                                       CCAGCCCGTGTGTACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCT
  3  -1   2       bld Spl1      ?                          CABK8343.3p                                                                                                                                                                                                                                       CCAGCCCGTGTGTACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAAAC
  5   1   2       bld Spl1      in                         CABK7734.5p                                                                                                                                                                                                                                        CAGCCCGTGTGTACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAG
  5   1   2       chi Int1      ?                         CAAP13612.5p                                                                                                                                                                                                                                           CCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGGTAAGTGATAACTTCCATACATAATCGAGGTGGCTGTGCTGTTAAGATATGCATATATTTTTTTAAAATACTGTACAGGTTTCTTGCTTTTCCACAAGTCATATACTGACATTGATACTTTATTTCTAGATTAAAATGGACATATTTGGACGTAATAGTCAAGTTGTCAATTATTTTGTTGTAAGCACAGTGAATTTTGTTAAGAAAAATTATTGCTGGCAGTTGAAAACATGTGTGGAGCCCGCTCATTTATACACGCCTACCAAGCATT
  5   1   2       bld Spl1      in                         CABK1318.5p                                                                                                                                                                                                                                           CCGTGTGTAACCACCCTCCGAGCACCTGGTGCAGCTCCTGGGAAATTGCCAAGGAATGCCAGGTGGAAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCA
  5   1   2       bld Gas7      in                         XZG46544.5p                                                                                                                                                                                                                                                                                                            GGAAAACAATGCTTGGAATTCTACTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACT
  5   1   2       bld Sto1      in                         CABG6193.5p                                                                                                                                                                                                                                                                                                                                   CTCTAATCGTGATTTGAAGAAGTCTTCTGAACCAGCTATTCAGATAGATTTATTCTATGAAAGTCTCTGTGGAGGTTGTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGANCATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTA
  5   1   2       chi Gas8      in                         st103n06.5p                                                                                                                                                                                                                                                                                                                                                                                      GGCCCTCAGTGTGGCCCGGGGCCCCTGTCCTGCTCTTCTGCTTGGCTTTCGGAGGGGCTCGGGAGGTGCAGGTCCCCGGGGGCCCGCTATACAGAGTGGAGGGGACGGCCGTGTCCATCCCGTGTAACGTGAGTGGGTACGAGGGCCCCTCCCTGCAGAACTTCGAGTGGTTCATGTACCGGCCGGCGGCCCCCGACCATTCCATCGCCATCGCCAGCACCAAGGAGAGCAAGTTTGCGTATGCGGTGTAATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCC
  5   1   2       bld Gas7      in                         XZG60583.5p                                                                                                                                                                                                                                                                                                                                                                                                         GGAGGTTGTAGACGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGANCATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAA
  5   1   2       bld Thy1      in                        CBST3918.fwd                                                                                                                                                                                                                                                                                                                                                                                                                GTAGAGGTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTG
  5   1   2       bld Gas7      in                         XZG39734.5p                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTCCTTGTCCGGCAACTTTTTCCATCGTGGCTGATGCTCGCTGAAATAATCAATGTGACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGNGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTG
  5   1   2       bld Ova1      in                         CABE5987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATTAGTTCCTTATGGGAATGCACAGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACCGAATTACTCCTGAATTGCTCCTACACAAAACTATTCCCACACC
  5   1   2       bld Tad5      in                         XZT59088.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAAACAAACATCACTGGTAAATGGGTTTTTGATTGCCAACATGGACCTGAGGAATGTCTGGGAAACATGATGGAGGCCTGTCTTATCCATATTCTTGATGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGT
  5   1   2       bld Spl2      in                        CBSS6282.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATATATACAAATATTTTCCAATCATTTTTTGCATGGAGTCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTNGTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATAC
  5   1   2       chi Spl2      in                        CBSS8823.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTCCAACAACGTCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAGAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTAT
  5   1   2       bld Ovi1      in                        CABI11510.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACATCACAAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTGAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAG
  5   1   2       bld Ova1      in                         CABE6608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAATCTTTGGAATCCTGCCTTGCAGTTTATGCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCCTGAAGC
  5   1   2       bld Thy1      in                        CBST7663.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCACCTGAGTTACCACTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTT
  5   1   2       bld Ova1      in                        CABE13214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCTCAAAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATNTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGG
  5   1   2       bld Spl2      in                        CBSS5473.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAACCAAAGGACTCAGTCCTCCTCACAATTATGTGCCCTGGATTGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCGTGTAATTTATTTCCAAC
  3   1   2       bld Gas7 5g3  in                         XZG44285.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTGCCCTGGATGGTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGC
  5   1   2       bld Spl2      in                        CBSS5054.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCATTGATGGGATGCACACTGATGATCTTCAAGCACAAGCTCAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAANNGCGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTG
  5   1   2       bld Ova1      in                         CABE9487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAGTTCTCTCTTTAACCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGA
  5   1   2       bld Spl1      in                         CABK7405.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTCTCTTTAACCCTTGTTTGTGACACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGG
  5   1   2       bld Spl2      in                        CBSS7726.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCGCACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGC
  5   1   2       bld Spl2      in                        CBSS9372.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCGCACATACAAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTNCACAGTAAAATT
  5   1   2       bld Gas7      in                          XZG3884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAAGGACAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGAT
  5   1   2       bld Liv1      in                         CAAR3270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGACCAAAGCCAGAACCCTGCTTGCACAGTGAAATAACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCNATGGGAGAAAATCAGGTTATTGAAAAGTAA
  5   1   2       bld Ova1      in                         CABE8674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGGGAAATACACCATTAAAAAGGGATGTTCTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAA
  5   1   2       bld Spl2      in                        CBSS1164.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGCCTAAACTGAATTACTCCTGAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGG
  5   1   2       bld Gas8      in                          st57n07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATTGCTCCTACAGAAAACTATTCCAACACCAGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCAT
  3   1   2       bld AbdN      in                       IMAGE:7007394                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACACCAGGGGCAAAATGTACTTTTCAAGACTAAACCGTGTGTTTTTGTTTTTCCCTTTTTTCTTTTTCTTTTCCCCAATTTCTTAATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTTCGTTCC
  5   1   2       bld Spl2      in                        CBSS7779.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTA
  5   1   2       bld Gas                            TGas016a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGA
  3   1   2       bld Liv1      in                         CAAR3270.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTTTGTTTTCCCTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACTTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAATCTAAAAAA
  3   1   2       bld Egg  FL   in                    TEgg021j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGTGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTTAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACCGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATTCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAA
  3   1   2       bld TpA       in                    TTpA024k03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGCAAATGTACTTTTCAGACTAACCGTGTGTTTTTGTTTTCCCTTTTTTCTTTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGTGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTTAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACCGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATTCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTTTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR6127.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGTTTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCANCAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCNCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAA
  3   1   2       bld Ova1      in                         CABE9487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTTCCCCTTTTTCTTTTTCTTTTCCCAATTTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl1      in                         CABK7010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTCCCTTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCC
  5   1   2       bld Sto1      in                        CABG12231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCCCTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGGTACTCATTAATAATAGGTGTATTAAAGGAATAGTANATCTAAAAAAAAAAAAAAGGAAAAAAAAAAAAAAAAAAC
  3   1   2       bld Spl1      in                         CABK7405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTTTTTCTTTTTCTTTTCCCAATCCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  5   1   2       bld Neu                            TNeu034o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTTTCTTTTTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCA
  3   1   2       bld Sto1      in                         CABG6193.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTTTCTTTTCCCAATTCTTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl1      in                         CABK3768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCTTTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAA
  3   1   2       bld Spl1      in                         CABK5536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl1      in                         CABK5624.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Egg  5g3  in                    TEgg049p06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAATTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAATCTAAAAAAAAAAAAAAAAA
  5  -1   2       bld Lun1      out                        CABD6287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCNTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCCAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAAT
  3   1   2       bld Ova1      in                         CABE5987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Ova1      in                         CABE2187.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAA
  3   1   2       bld Gas       out                   TGas071p20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGTTTTCCCTTTTTTCTTTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGTGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTTAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACCGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATTCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAATCTAAAAAAAAAAAAAAAA
  5  -1   2       bld Liv1      in                        CAAR10134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAA
  3   1   2       bld Hrt1      in                        CAAQ12878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCTTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCC
  3   1   2      seed Gas  5g3  in                    TGas088n10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE8674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Ovi1      in                        CABI11510.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  5   1   2       bld HdA       in                   THdA012k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACTTTCAACAGTATAACNNTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Sto1      in                        CABG12231.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTACTTCCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAG
  3   1   2       bld Ovi1      in                        CABI11548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGTACTTTCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAA
  5   1   2       bld Spl2      in                        CBSS9672.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAACAGTATAACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCA
  3   1   2       bld Spl1      in                         CABK2961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTATATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA031l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTTGGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTTTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGGGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTTTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTNTAAAGGAATGTAAATTTAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Ova1      in                        CABE13214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTTTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl1      in                         CABK1318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTNTGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAATCCAAAAAAA
  3   1   2       bld Spl2      in                        CBSS3670.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGTGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTTAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACCGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATTCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Ova1      in                         CABE6608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCACCTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Ski1      in                         CABJ4310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCTTGCATTTCACTAGAGGCCTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl1      in                         CABK7734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCC
  3   1   2       bld Spl2      in                        CBSS1164.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2 5g3  in                        CBSS1406.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCATTTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Ova1 5g3  in                        CABE10023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTTCACTAGAGGGCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Gas8      in                         st103n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCATTCACTAGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTACTCATA
  3   1   2       bld Abd0      in                       IMAGE:6999383                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCACTAGAGGCCTTCTTCATACAGGGTTGCAGGGTGAGACCTTTNAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGCTACTCATTAATAATCGGTGAAAAGAGCAAAAA
  3   1   2       bld Gas7      in                         XZG46544.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAGGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Spl2      in                        CBSS5054.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAGAGCCTTTCTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTNTAAAGGAATAGTAAATCT
  3   1   2       bld Gas7 5g3  in                         XZG47083.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTAAAACTGTATTGGAGTGTGTAAATGGGGATTTGGGGAACAAGCTTATGCACGAAAATGCCCAAACTGTGACTGAATGGCTATGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAATCC
  3   1   2       bld Ova1      in                        CABE11194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Ova1      in                         CABE4561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATGGAAATCC
  3   1   2       bld Gas7      in                          XZG3884.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATAAAGGAATAGTAATCTAAAAAAAAAAAAAAGG
  3   1   2       bld Gas8      in                          st57n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTACTCA
  3   1   2       bld Thy1      in                        CBST7663.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2      in                        CBSS9372.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Gas7 5g3  in                         XZG47443.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Tad5 5g3  in                         XZT48782.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATACAGGGGTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld TpA  5g3  in                    TTpA061d08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACAGGGTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGTGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTTAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACCGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATTCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAATCTAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA012k09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTGCAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTTTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATAAAGGAATAGTAATCTAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Thy1 5g3  in                       CBST13190.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGTGAGACCTTTTAATGGTGTATGTTCCCTGACATGACAATGCTCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld TbA  5g3  in                    TTbA072n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGACCTTTTAATGGTGTATGTTCCNTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCGATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCGGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCGTTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATGTAAATCTAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas7      in                         XZG60583.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCTTTTAATGGTGTATGTTTCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATTTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAGGAAT
  3   1   2       bld Lun1      in                         CABD6484.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGTGTATGTCCCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGTTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTAGGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAAAAC
  3   1   2       bld Thy1      in                        CBST3918.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATGTTCCNTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTNTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2 5g3  in                        CBSS1705.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Tad5      in                         XZT59088.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGACATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACCCAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTTTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGGGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2 5g3  in                        CBSS3137.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS5473.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2      in                        CBSS7726.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAATGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2      in                        CBSS6762.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTTTTGTAATTTATTTCCAACCCTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTCCCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTTTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTTTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACCCATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATTT
  3   1   2       bld Spl2 5g3  in                       CBSS10409.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCAAACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2      in                        CBSS7779.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2      in                        CBSS6282.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2 5g3  in                        CBSS9164.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGACTGAATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTNTAAAGGAATAGTAAATCT
  3   1   2       bld Gas7 5g3  in                         XZG63635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAGGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACCCTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGCGGAGATGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTTTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTTTTAGAAGCTGTCCCTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACCTTCCTCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGGGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTAGGGTTACTCATTAATAATAGGGGTATTAAAGGAATAGTAAATCTAAAAAAAAAACAAATAAACCCAAAT
  3   1   2       bld Tail 5g3  in                         CBSW1241.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGCGGAGATGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAAAATTCATCATATTTATAGAGTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCATATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAA
  3   1   2       bld Tail      in                        CBSW12242.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGGTGTATTAAAGGAATAGTAAATCTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  in                         CCAX9246.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCTACGTACTACTAATTCACATCTGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTA
  3   1   2       bld Gas7      in                         XZG38732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGGCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGCGGAGATGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCCCTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAATTCT
  5   1   2       bld Gas7      in                         XZG38732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGCGGAGATGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCTAANANAAAAAAAAAAAAAANAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG39734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTAAATGTGTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTGGGGTGCTTTCTGCTGATACTATTTGGGTCCCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCACCCCTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTCCCTCAGTCTTTCCTGAAGGGGGAGACGACTTGATCAGTTTTGTAGGCTTTACCCAAACAAACTAACTGGGAAATTTTTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGCCCGGAAGAGGCGGTATCCATAACTAGTCACCAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCCCTCTAGATAACCAATGGGGGAAAATCAGGTTTTTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTCCCCATGGTTTTCAGTGAAAGGAAAATGGGGAAATGAAATTAAGAGGCATTTAAATTCTTTACTGCTTCCCGTAGGGTTACTCATTAATAATGGGGGTTTTAAAGGAATGGTAATTCT
  3   1   2       bld Spl2      in                        CBSS7860.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Ova1      in                        CABE12236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGCCTCT
  5   1   2       bld Ova1      in                        CABE12236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTAGTGTAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAG
  3   1   2       bld Spl2      in                        CBSS8823.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAATGGAATACCTAGTTGACATTGTTGTGGTTTGACCTGTACACATTATGGGCAGACTTGGGTGCTTTCTGCTGATACTATTTGGTTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCATAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAATCTTTCCTGAAGGTGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTTAGTGACAGGAAGAGGCGGTATCCATAACTAGTCAACCGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATTCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Spl2 5g3  in                        CBSS9667.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATACTATTTGGGTACCAGCTGTTTTTATCTAGACCTATCCCCAGTTTCATCAACCACAAACACCTGCACAGTATGCCACAACCCCAGTGCCAACTTCTTGTAATTTATTTCCAACACTACAGATTTATGCAAGATAAAGAAAGTTGTGTTAGCAATTAGGAAAACAAATTGATCTACCTCAGTCTTTCCTGAAGGCGGAGACGACTTGATCAGTTTTGTAGGCTTTACACAAACAAACTAACTGGGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT
  3   1   2       bld Gas7      in                          XZG6909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGTATTGGGAAATTATGGGGGCAAAAGTGTTTAAAGCATAGAAAATAAACTTTCCAAGTTCATGCCTTTTCAGCGACAGGAAGGGGCGGTATCGATAACTAGTCAACAGTAAAATTAGGCTGCACCCTTTTTGGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCGGGTTTTTGAAAAGTAAAGAAACATTCATCATATTTATGGATTTTTCTAATTACACAGGGTTTTCAGTGAAAGGAAAATGGGGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTC
  3   1   2       bld Spl2      in                        CBSS9672.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAATTATTGAGGCCAAAGTGTCTAAAGCATAGAAAATAAACTTTCCAAGTTCACTGCTTTTCAGTGACCGGAAGAGGCGGTATCCATAACTAGTCAACAGTAAAATTAGGCTGCAGCCTTCTTAGAAGCTGTCACTCTAGATAACCAATGGGAGAAAATCAGGTTATTGAAAAGTAAAGAAACATTCATCATATTTATAGATTTTTCTAATTACACATGGTTTTCAGTGAAAGGAAAATGGAGAAATGAAATTAAGATGCATTTAAATTCTTTACTGCTTACCGTATGGTTACTCATTAATAATAGGTGTATTAAAGGAATAGTAAATCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)