Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012070525 Xt7.1-TTpA004o21.5.5 - 181 ESTs
                                                                       ...-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA004o21.5.5                                  TACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACCAAAAAAAAAAAAAAAAAAAGC
                                                  Xt7.1-CHK-1008222017                                        AAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAxxxTxACCAAAAAAAAAAAAAAAAAAAxxAAAAAA
                                                      consensus depths                                       7    11     9    12    13    16    13    16    14    18    19    22    22    25    25    28    28    31    31    35    39    45    44    49    48    53    54    62    54    65    64    73    67    76    67    79    76    81    78    83    78    84    80    86    81    89    85    92    84    92    90    93    88    93    89    93    84    92    86    92    84    91    86    91    85    91    85    91    87    91    87    90    87    90    90    93    93    95    91    97    94    98    96    98    96    98    94    98    94    97    97    99    96    99    98   100    95    98    95   101    94    99    97   100    95    99    95   100    93    97    90    98    91    98    89    97    85    92    76    85    76    81    73    77    62    70    63    70    65    71    60    70    64    69    61    65    59    64    69    72    68    72    77    81    78    82    80    82    76    80    75    79    76    81    75    81    69    78    72    78    72    81    74    82    72    81    74    80    71    79    70    78    69    76    71    77    70    77    70    77    68    77    68    78    72    79    68    79    69    80    68    79    68    80    73    81    66    81    71    80    69    79    70    79    70    77    66    78    62    74    62    74    57    73    58    72    47    72    47    71    47    70    45    70    39    69    44    69    45    70    41    66    42    66    39    65    41    64    41    64    41    63    40    63    39    64    38    63    36    62    36    61    37    60    35    55    31    52    29    46    18    37    10    18     9    13
  5   1   2  SIG                                    Xt7.1-TTpA004o21.5             CTGCCTGTTTGTAGGATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACCAAAAAAAAAAAA
  5   1   2  SIG                                  Xt7.1-EC2BBA18CE05.5                                                                                                 GCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAAC------------------------------------------------------------------------GCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAAACAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                              AGAGCATCATAAGAGCACCTCATCTGTCTGACGAGTTCTCCTTTTTCCCTATTTCACAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATCAGTGTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCTCTTTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTATACATAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --C--C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                               BLH ATG     283     454                                  
                                               BLH MIN     283      44                                  
                                               BLH MPR     283      44                                  
                                               BLH OVR     283     728                                  
                                               CDS MIN     283      44                                  
                                               EST CLI     107       8                                  
                                               ORF LNG     283      26                                  
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 3e-044     NP_957263.1 similar to synuclein, beta [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 5e-057     NP_990002.1 beta-synuclein [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 3e-058     NP_291088.1 synuclein, beta [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 5e-060     NP_003076.1 beta-synuclein [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 6e-066     AAH84970.1 LOC495448 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 6e-066     NP_001088570.1 hypothetical protein LOC495448 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xt ==== 2e-069     AAH59756.1 Unknown (protein for MGC:75784) [Silurana tropicalis] ==================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTpA004o21.5.5                                                                                                        TAG------------TAG------ATG------TAG---TGA------------------------TGA------------------------------------------------------------------TGA------------------------------------TGA------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------ATG---------------------------------TAA---------------------TGA---------------------------TGA---------------------------------------------------ATG---------------------TAG---------------ATG---------------------------TGATAA---ATG------ATG---------------------------------------------------------------------------------------------------------TAA---------------------------------TAGATGTAATAG------------------------------------------------------------------------TAA------------------------------ATG---------------------------------------------------------------------TGA---------------------------TAG------ATG---------TGA------TAA------------ATGTGA------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------TGA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2  SIG                                    Xt7.1-TTpA004o21.5             CTGCCTGTTTGTAGGATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008273102                   GTTTGTAGGATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGAxTxACCAAAAAAAAAAAAAAAAAA
  0   1   1           TpA  FL                     TTpA004o21.FL-Sanger                                                                                 CTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACCAAAAAAAAAAAAAAAAAA
  5   1   1           Tad0 FL                     IMAGE:5381977.FL-MGC                                                                                                                                                                                                                                     GATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTACCCAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       add HdA  5g3  in                   THdA033o05.p1kSP6 AGGAGGGGCCCGAAATATTGGGTTGCTATGCTTCAGGTTCATATTCCTGGTAATCGTCCTGTGGGGCCTCATTATAGCTATCTTTGTGCTGATGTTGCTGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCTAGAAGACTAAGCAAGGGGTAGC
  5   1   2       ext BrSp 5g3  in                      EC2BBA7CF03.g1          GGGCTGCCTGTTTGTAGGATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCCTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCATGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAACCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTGTATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAGCATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTG
  5   1   3        nb HeRe 5g                          EC2CAA29DA05.g1             CTGCCTGTTTGTAGGATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTG
  5   1   2       ext TpA  5g3  in                   TTpA067m03.p1kSP6                   CCCCGGGGAATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAGATGGATGAAGCCCACCTCCCTTTTCTC
  5   1   3        nb HeRe 5g                          EC2CAA36BA06.g1                       GTAGGATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGA
  5   1   3   12   nb Tad5 5g3  in                         XZT21622.5p ........................AGGATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGNCACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCTTTCAAAGATGGATG
  5   1   3        nb TbA  5g3  in                   TTbA002g14.p1kSP6                          AATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCATGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACGGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCACGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCGACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTC
  5   1   3   30   nb Eye  5x3                              CCAX961.b1 ...........................ATCTCCTACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACC
  5   1   2       add HeRe 5g3  in                     EC2CAA12CF07.g1                             GGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGTAAGGCAAAGAGAAGGGCTGGCTGGTTGGCAGATCTCCATTTCCAGAGAGCATCATAAGAGCACCTCATCTGTCTGACGAGTTCTCCTTTTTCCCTATTTCACAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAACTTGGGGGAGCCGTCATGTCTGGGGCT
  5   1   3        nb BrSp 5g                          EC2BBA10CD11.g1                                GGGACCACAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCAC
  5   1   2       ext TpA  5g3  in                   TTpA064l18.p1kSP6                                  CCTCCCAAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTTCAGTCACCTGCA
  5   1   3        nb Tad5                                  XZT1282.5p                                       CCAGGGGGTACACAGCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTC
  5   1   3        nb BrSp 5g3  in                      EC2BBA7CG12.g1                                                    GGGACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCC
  5   1   3   10   nb Eye  5g3  in                         CCAX5587.b1 ....................................................GCACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGA
  5   1   3   14   nb Brn4 5g3  in                        CAAL23535.5p .....................................................CACGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTA
  5   1   3        nb TbA  5g3  in                   TTbA032j17.p1kSP6                                                                              TGCTTCTCTCAAAAGGAGGCGGGTGTATGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACGCTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCTTCTGAGCCCTCCTCTGCCTCATCTCCACACTCAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCATGCAGCTTATTTTGCACAGGAAGCTGTAACTGAAAGAATAGAGGTCTTGGAAGACTGCAACATATCACCAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAACGAAGGTGTGGTGGCTGCATCCGAGAAGACTAAGCAAGGGGTATCGGAGGCTGCACATAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCTTAACCCGAGATGGAGTGGTGCAAGGACTGGCTTCTGTGGCTGAAAAGAGCAAAGAGCATGCATCTCAGCTTGCGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGCACTGGTGAATAACGATGAGTTCCCTACAGACATCACGCCTGAACAGGAGGCCCAGGAAGCCTTGGAATAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGATAGATCTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCCTGACAACCCAATATTTCGGGCCCCT
  5   1   3        nb TpA  FL   in                   TTpA004o21.p1kSP6                                                                                 CTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGA
  3   1   3        nb BrSp 5g3  in                      EC2BBA8AD07.b1                                                                                   GGGGAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTAACAGGAATATGAACCTGAAGCATAACAACCCAATATTCAGGCC
  5   1   3        nb BrSp 5g3  in                     EC2BBA29AC12.g1                                                                                    GGGAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGAGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCA
  5   1   3        nb BrSp 5g3  in                      EC2BBA8AD07.g1                                                                                    GGGAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed HdA  5g3  in                  THdA035o13.p1kaSP6                                                                                                  CGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGT
  5   1   3        nb TpA  5g                        TTpA030j13.p1kSP6                                                                                                    GGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCNCTAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTA
  5   1   3        nb TbA  5g3  in                   TTbA038i14.p1kSP6                                                                                                              CTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCGTAAGCCCCCCT
  5   1   2       ext TbA  5g3  in                   TTbA038i17.p1kSP6                                                                                                              CTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGNCACATCAGCACAAAGATAGCTATAAT
  5   1   3   10   nb Eye  5g3  in                         CCAX8647.b1 .................................................................................................................GAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGA
  5   1   3        nb BrSp 5x3  out                    EC2BBA19BF07.g1                                                                                                                        GGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGC
  5   1   3        nb BrSp 5g3  in                     EC2BBA22CE09.g1                                                                                                                        GGGATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTC
  5   1   2       add BrSp 5g3  in                     EC2BBA24BD09.g1                                                                                                                                         GGGGAGGTAAGGCAAAGAGAAGGGCTGGCTGGTTGGCAGATCTCCATTTCCAGAGAGCATCATAAGAGCACCTCATCTGTCTGACGAGTTCTCCTTTTTCCCTATTTCACAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGC
  3   1   3        nb BrSp 5g3  in                     EC2BBA21CB10.b1                                                                                                                                             GGGGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCA
  5   1   3        nb BrSp 5g3  in                     EC2BBA26DH06.g1                                                                                                                                             GGGGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCCTTTC
  5   1   3        nb BrSp 5g3  in                     EC2BBA35CC09.g1                                                                                                                                              GGGACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAATAGGCC
  3   1   3        nb BrSp 5g3  in                     EC2BBA18AG11.b1                                                                                                                                               GGGGACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATAAAAAAAAA
  5   1   3        nb BrSp 5g3  in                     EC2BBA21CB10.g1                                                                                                                                               GGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAG
  5   1   3        nb BrSp 5g3  in                     EC2BBA18AG11.g1                                                                                                                                                GGGACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAAAAAAAAAAAAAAAAA
  5   1   2       add BrSp 5g3  in                     EC2BBA18BF07.g1                                                                                                                                                GGGACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCACCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCACGCCTGAAGAGGAGGCCCAG
  3   1   3        nb BrSp 5g3  in                     EC2BBA26DH06.b1                                                                                                                                                GACACTGCCTGCGAAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCT
  5   1   3        nb HeRe 5g                          EC2CAA32BC03.g1                                                                                                                                                  GACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGACGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb HeRe 5g3  in                      EC2CAA3CH05.g1                                                                                                                                                  GACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAACAAGGATGAGTTCCCTACACACATCAAGCCTGAAGAGGAGGCCCAGCAAGCCTTGGAACAACCTGCAGCTG
  5   1   2       add BrSp 5g3  in                      EC2BBA7DA10.g1                                                                                                                                                          GGGGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGTAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCC
  5   1   2       add HdA  5g3  in                   THdA045d04.p1kSP6                                                                                                                                                          AGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCGCACAGAAGAACAAAAGAGGCAGATTTTCCTGTGAATCTCATGCAGCTTATTTTGCACATGCAAGCTGTAGCTGAAAAAATAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAAGCTTGTCCAAAGCACAGGAAGGTGTGGTGGCTGCAGCCCAAAAGACTAAGCAAGGGGTAGCGGAAGCTGTCACAGAAAACCAAGGAAGGTGTCCTATACTGTGGGAAGCAAAACCCCATATGGAATGGTGCAAGGAGTGGCTTCTGTGCGCTGAAAAGACCAAAGAGCAAGCGTCTCACCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCATCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTNCAAAGATGGATGAAGCCCACCTCCCTTTTCTCCCTAGAAGTGACTTCTTCCTTCAGTTCACCTGCAG
  5   1   3        nb HdA  5g3  in                   THdA047h22.p1kSP6                                                                                                                                                              AGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGT
  5   1   3   34   nb Brn4 5g                             CAAL22302.5p ...............................................................................................................................................................GGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAA
  3   1   2       ext BrSp 5g3  in                      EC2BBA7CF03.b1                                                                                                                                                                 GACCCCCTGTGAGCCTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAACCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTGTATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAGCATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAGCCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCA
  5   1   3        nb Tad5      in                         XZT12623.5p                                                                                                                                                                 GGACCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAA
  3   1   3        nb BrSp 5g3  in                      EC2BBA8DC07.b1                                                                                                                                                                       GGGGGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTAACAGGAATATGAACCTGAAGCATAACAACCCAATATTAAGGCCCCTCCACCAGCAACACAGCACAA
  5   1   3        nb BrSp 5g3  in                      EC2BBA8DC07.g1                                                                                                                                                                        GGGGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATAAAAAAAAAAAAAAAAAAAA
  5   1   3   14   nb Brn4 5g3  in                        CAAL21068.5p ................................................................................................................................................................................TGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAA
  5   1   3   12   nb Tad5 5g3  in                         XZT35614.5p ................................................................................................................................................................................TGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAG
  5   1   2       add BrSp 5g3  in                      EC2BBA7DA08.g1                                                                                                                                                                                   GGGATTTCCAGAGAGCATCATAAGAGCACCTCATCTGTCTGACGAGTTCTCCTTTTTCCCTATTTCACAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTCCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAACCCCCCCTTTCAAAAGATGGATGA
  5   1   3   14   nb Brn4 5g3  in                        CAAL18287.5p ...................................................................................................................................................................................ATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAG
  5   1   3        nb BrSp 5g3  in                     EC2BBA14CG01.g1                                                                                                                                                                                     GGGGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGGGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTC
  3   1   2       add BrSp 5g3  in                      EC2BBA7DA08.b1                                                                                                                                                                                     GATTTCCAGAGAGCATCATAAGAGCACCTCATCTGTCTGACGAGTTCTCCTTTTTCCCTATTTCACAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTCCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACAAGCAGAGAACCTCATGTGAAGTGATTTTATGT
  5   1   3        nb HdA  5g3  in                   THdA035o12.p1kSP6                                                                                                                                                                                       TGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAGAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAGAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGC
  3   1   3        nb BrSp 5g3  in                      EC2BBA7CG12.b1                                                                                                                                                                                         AGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTAAGTGATTTTATG
  3   1   3        nb BrSp 5g3  in                     EC2BBA23DH08.b1                                                                                                                                                                                           GGGGCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACACAGCA
  5   1   3   14   nb Brn4 5g3  in                        CAAL23745.5p ..........................................................................................................................................................................................CCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCCAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGA
  5   1   3        nb BrSp 5g3  in                     EC2BBA23DH08.g1                                                                                                                                                                                             GGGCCTCTGCCTCATCTCCCACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATAAAATAAAAAAAAAAAAA
  5   1   2       add TpA  5g                        TTpA073p07.p1kSP6                                                                                                                                                                                                 CATAAGAGCACCTCATCTGTCTGACGAGTTCTCCTTTTTCCCTATTTCACACGCAGGCTTATTTTGCACAGGTAAGCTGTAGTCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGTAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGAGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCACCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACGTTGCTGCAGCTACTGGACTGGTGAATAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCATCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCCAGGAATTATTTCTG
  5   1   3   20   nb Eye  5g                              CCAX7558.b1 ...................................................................................................................................................................................................GCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGGAAGG
  5   1   2   12  add Tad5 5g3  in                         XZT22709.5p .........................................................................................................................................................................................................GAGCACCTCATCTGTCTGACGAGTTCTCCTTTTTCCCTATTTCACAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAG
  3   1   3        nb BrSp                             EC2BBA21BG09.b1                                                                                                                                                                                                           GGGGACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGGGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAAAAATATGAACCTGAAGCATAACAACCCA
  3   1   3        nb BrSp 5g3  in                     EC2BBA18CC03.b1                                                                                                                                                                                                             GGGGACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTTAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCA
  5   1   3        nb BrSp 5g3  in                     EC2BBA18CC03.g1                                                                                                                                                                                                              GGGACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTTAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCCAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb BrSp 5g3  in                    EC0CBA005DF01.g1                                                                                                                                                                                                                   GGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGACGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGC
  3   1   3        nb BrSp 5g3  in                     EC2BBA29AC12.b1                                                                                                                                                                                                                   AGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGAGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAG
  3   1   3        nb BrSp 5g3  in                     EC2BBA22CC08.b1                                                                                                                                                                                                                     GGGGAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGTTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACACA
  5   1   3        nb BrSp 5g3  in                     EC2BBA22CC08.g1                                                                                                                                                                                                                      GGGAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTG
  5   1   3   34   nb Brn4 5g                             CAAL23149.5p ........................................................................................................................................................................................................................AGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGA
  5   1   3   12   nb Tad5 5g3  in                         XZT34157.5p ............................................................................................................................................................................................................................GAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAANAAA
  5   1   0       chi Eye       in                         CCAX2464.b1                                                                                                                                                                                                                                 GGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTA
  5   1   3   14   nb Brn4 5g3  in                         CAAL5799.5p .................................................................................................................................................................................................................................GCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAG
  5   1   2       add BrSp 5g3  in                      EC2BBA6DA08.g1                                                                                                                                                                                                                                   AGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACT
  5   1   3   10   nb Eye  5g3  in                         CCAX5685.b1 ...................................................................................................................................................................................................................................AGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAG
  5   1   2       ext Tad0 FL   in                    IMAGE:5381977.y1                                                                                                                                                                                                                                     GATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCA
  5   1   3        nb TpA  5g                        TTpA078c15.p1kSP6                                                                                                                                                                                                                                                  AGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGAATAANAAAAGA
  5   1   3        nb BrSp 5g3  in                     EC2BBA11AD11.g1                                                                                                                                                                                                                                                        GGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAAAAAAAA
  5   1   3   14   nb Brn4 5g3  in                        CAAL22710.5p ............................................................................................................................................................................................................................................................CTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCC
  5   1   2       add TpA  5x3  out                  TTpA058k21.p1kSP6                                                                                                                                                                                                                                                                 CCCGGGGCAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAAAAAAAAAAGCGGCCCTATAAATGTATGCCCAAACACGCTTTATGGTCTTGTTTAGGGATACACTGTTGGCTTCCTCTTACCACTTGATTTTCTCTCCCTGTTATGGGGTTCATAGGAATGTGTTTATGTCCCGTATCAATGGGAGTTACATCCTTGAATCCTGTGGTAGCCTCTGACTCCTTAAACACAAATTAGACAAGTTTATTAAAAGCCTTATTGCATTGTTAGATATACAGGCAGAAATCTAAGACATTAAGCAGTTGAGGTGCATACACAAACCAATCTAATGTCCTCATGCTTCCTCTGTACCGAGACATTTTGGGTTTCTCCTGATAAATGGTCTGCTGTGTAAAAGTGTC
  3   1   3        nb BrSp 5g3  in                     EC2BBA11AD11.b1                                                                                                                                                                                                                                                                             AGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAAAGAACCTCATGTGAAGTGATTTTATGTATGGT
  3   1   2       add Brn4      out                         CAAL672.3p                                                                                                                                                                                                                                                                                           AACGGGAGGTTTTGGTAGAGTTCAACCAATCAGAATGGATGCATTTATGAAAGTCTTGTCCAAAACAAAGGAAGGTGTGGTGGCTGCAGCAGATAAGAGTATGCAAGGGGTATCGGAGGCGGCAGAGAAAACCAAGGAAGGTGTCGTTTATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATG
  5   1   3        nb BrSp 5g                          EC2BBA33DG09.g1                                                                                                                                                                                                                                                                                              GGGCTCCCTCTGCAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTT
  5   1   2       add Tad5      in                         XZT36005.5p                                                                                                                                                                                                                                                                                               CCCACGCGTCCGCCCACGCGTCCGCGGACGCGTGGGGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGANAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGC
  5   1   3        nb BrSp 5g3  in                     EC2BBA25CG10.g1                                                                                                                                                                                                                                                                                                  GGGCTCTGCAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTCCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAACGAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb TbA  5x                        TTbA077p16.p1kSP6                                                                                                                                                                                                                                                                                                    CTGCAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGGCTCGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTCGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACAGGACTGGTGA
  3   1   3        nb BrSp 5g3  in                     EC2BBA25CG10.b1                                                                                                                                                                                                                                                                                                            AGACTGCAGCAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAACCCAAGGAAGGTGTTCTATATGAAAAAACAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTGTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACAAGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACAAAAAATATGAACCTGAAGCATAACAACCCAA
  5   1   3   20   nb Tbd1 5g                              CBXT1025.b1 .............................................................................................................................................................................................................................................................................................................CTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAGACTAAGCCAAGGGGTAGCCGGAGGCCTGCAGAGAAAAACCAAGGAAGGTGTTCTATATGTGGGAAAGCAAAACCCCGA
  3   1   3        nb BrSp                             EC2BBA25DH03.b1                                                                                                                                                                                                                                                                                                                 GGGGAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTAGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGC
  5   1   3        nb Tad5      in                         XZT16539.5p                                                                                                                                                                                                                                                                                                                                     GCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCC
  5   1   3        nb Brn4      in                         CAAL7309.5p                                                                                                                                                                                                                                                                                                                                                    TCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGNGGGCCCTGCACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAAAAGCATGTTTTATCTTTT
  5   1   3        nb Brn4      in                        CAAL22367.5p                                                                                                                                                                                                                                                                                                                                                                                                  CAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAG
  5   1   3        nb Brn4      in                         CAAL5867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAA
  5   1   3        nb Brn4      in                        CAAL11308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCC
  3   1   3        nb Brn4 5g3  in                        CAAL21068.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTGGCTGAAAGACCAAAGAGCAGGCATCTCAGCTGGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTATGAAAATTATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACC
  5   1   2       add BrSp                            EC0CBA001BH01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGTCACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTCCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTCGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCC
  5   1   3        nb TpA       in                   TTpA066c14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGACCAAAGAGCAGGCATCTCATCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCTGCTACTGGACTGGTGAACAAGGATGACTTCCCTACCGACATCCCGCCTGAATAGGAGGCCCATTAAGCCTTGCAAGAACCTGCTACTGACCCTCTCCTGCAACCTGAATGATAGAACTATGAACAGGCCCCACAGGTACATATTACCAGGTAATATGAACCTGAAGCATAACAACCCAATATTTCTGGCCCCTC
  5   1   3        nb HdA       in                   THdA022f11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGGCACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATNAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTNACTACTCGTTGCCCAAAGTGGGCATTCGTGAAAGTTAAAGGAAAGCCAAAAAAAAATT
  5   1   3        nb Tad5      in                          XZT6573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGNGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAA
  5   1   3        nb Tad5      in                          XZT5144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCCTGCACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATAT
  3   1   3        nb HeRe 5g3  in                      EC2CAA3CH05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAA
  3   1   3        nb BrSp 5g3  in                     EC2BBA35CC09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGC
  5   1   3        nb Tad5      in                         XZT65892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAAT
  5   1   3        nb Tad5      in                         XZT10978.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAA
  3   1   3        nb BrSp                             EC2BBA11AA02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATCAACAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGGGTGTATACTTACATAAAAT
  5   1   3        nb Brn4                                 CAAL6575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAG
  5   1   3        nb Brn4                                CAAL18641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGNGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGT
  5   1   3        nb Brn4      in                        CAAL23378.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTAATCTTTTTATATACATATGGTGCACAAACACCACCAAA
  3   1   2       add HeRe 5g3  in                     EC2CAA12CF07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTCCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTCGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCTCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGC
  5   1   3        nb Brn4      in                        CAAL21197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTC
  5   1   3        nb Tad5      in                         XZT43598.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCACGCGTCCGCCCACGCGTCCGCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAGCGGAGAGAAATCTGTG
  5   1   3        nb TbA       in                   TTbA033j24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAACCTGAAGCGTAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCATCACAGAGATAGCTATAATGAAGAACAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAACGTTGAGTCATACTCCAAGCAAAAATGGATGTTTAAAACAAACAAAAAAACAATCCCTTGATAATGTATGAAAATCATGAATGCATTGGTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAAATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCTACCGAACCAGCGAATACTGCAGCATGTCTACCAACATAAAATAACCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCGCCATCAAACAAAAGACTTTTCCGTTTAACTACTCGTTTG
  5   1   2       add Tad0                               IMAGE:6985852                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAGGGCTGGGGTACCGGGTCCGGGAATTCCCGGGGATGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTTATTGTGACGTTCTGTAAAGCGAAGAGAATCTGTGAGAATCATACAGATCTTTTGATGTC
  3   1   3        nb Brn4      in                        CAAL21197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAAAAAAAGATNCAAATAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTACC
  3   1   2       add Tad5      in                         XZT36005.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAAAGATNCAAATAAGTTTCCCTTTCCTAAGCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATT
  3   1   3        nb Tad5      in                         XZT43598.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATAAAGTTTCCCTTTCTAAGCCCNCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATT
  3   1   3        nb Brn4 5g3  in                         CAAL5799.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAGCCCCCCTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACCAAAC
  3   1   3        nb HdA       in                    THdA022f11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCCCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAAGGAATAAAAAAAGATTACCAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Brn4      in                        CAAL11308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCNCCTTTCAAAAGATGGATGAAGCCCACCTCCCTTTTCTCCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   3        nb Tad5      in                         XZT10978.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTCCCTTTTCTCTTAAGAAGTGACTTCTTCCTTCAGTTTCCCCGGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACA
  3   1   3        nb Brn4      in                         CAAL5867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTACC
  3   1   3        nb Tad5      in                         XZT16539.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATT
  3   1   3        nb Tad5 5g3  in                         XZT35614.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   3        nb BrSp 5g3  in                     EC2BBA14CG01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTCTTGTGTTCCAAATAAT
  3   1   2       add BrSp 5g3  in                     EC2BBA18BF07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTCGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTAAATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTCTTGTGTTCCAAATAAT
  3   1   3        nb Brn4      in                        CAAL23378.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   3        nb Brn4      in                         CAAL7309.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTGC
  3   1   3        nb Tad5 5g3  in                         XZT34157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATT
  3   1   2       add BrSp 5g3  in                      EC2BBA6DA08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTTCGCTGTTGTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAA
  3   1   2       add Tad5 5g3  in                         XZT22709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGTGACTTCTTCCTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATT
  3   1   2       add BrSp 5g3  in                      EC2BBA7DA10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTCGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGCTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTAAATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTAAATTCCAAATAAT
  3   1   3        nb HdA  5g3  in                    THdA047h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAAATAATTTTGCAAAATGAATAAAAAAAGATTACCAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Brn4 5g3  in                        CAAL22710.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   3        nb Tad5      in                          XZT6573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAAGGAATAAAAAAAGAT
  3   1   3        nb TbA       in                    TTbA033j24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATAAATTTCGTAAACAGTTTTTGTTTTTATTTTTTGTTAAGAAGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATATTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACCCCACCAAAAAAAAAAGACTTTTCCGTTTAACTATTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGGGAAAGTTCTCTCTTTTTTGGCGGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACCAAAAAAAAAAAAA
  3   1   3        nb TbA  5g3  in                    TTbA038i14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGTTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATT
  3   1   2       ext TbA  5g3  in                    TTbA038i17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGTTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCCCCAAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAAGGAATAAAAAAAGATTAACCAAAAAAAAAAAAAAAAAAAAGCG
  3   1   4      seed HdA  5g3  in                    THdA035o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGCTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATANATTTTGCAAAAGGAATAAAAAAAGATTACCAAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Tad5 5g3  in                         XZT21622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   3        nb BrSp 5g3  in                     EC2BBA22CE09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGAACCTCATGGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAA
  3   1   2       add HdA  5g3  in                    THdA033o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCCCCAAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAAGGAATAAAAAAAGATTACCAAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Tad5      in                         XZT65892.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACGGTTTTTGTTTTTATTTTTGGTTAAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGTTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACCCCCCCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGCCCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGTTTACCC
  3   1   2       ext TpA  5g3  in                    TTpA064l18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTTGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGGATTAACCAAAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb TbA  5g3  in                    TTbA002g14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGATGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAANATAATTTTGCAAAAGGAATAAAAAAAGATTACCAAAAAAAAAAAAAAAAGC
  3   1   3        nb Eye  5g3  in                         CCAX5685.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   2       add Eye       in                         CCAX2464.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   3        nb Tad5      in                         XZT12623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTNCCAAAAAAAAAAAAAAAT
  3   1   2       add HdA  5g3  in                    THdA045d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATAGTCCAAGCAAAAATGGATGTTTAAACCAAAGAAAAAAAGAATCCCTCGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTTTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGGGAATTTTGTGTCTCAGCTCAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTAAGACGAAAAACCTGATTGGGGGCCAGGGGGGCCTGCAACTCCCTGCAACTGTCCCAGCTAATTCTGCGGGGTGTGTACGTACATAAAATAAGCATGTTTTATCTTTTTTTATACATGCGGGGCCCAAACCCCCCCAAAAAAAAAAGACTTTTCCGTTTACACCCTGGTTTGCCCAAAGCGGGCCTTCGTGAAGTTTAAAGGAAACCCAAAAAAAAATTTGGCGGGGGAGGACCGCCCTTTGACATAGTTAAATCAGGGTTCTAAGGAGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTGTACCTATCTACATATCTACAAATATATATATGGTTTAATCCATTTGTGCCCGTTCTGTAAAGACGGAGCAAACATCTGTGGGAATCCATACAGAATCTTTTGAATGTTTTTGTTTCCAAATAATTTTGCAAATTGATTAAAAAATGATTCCCTACAAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Brn4 5g3  in                        CAAL18287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTGGTTAAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGTTAATACTGCAGGGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATAGGGGGCCCAAACCCCCCCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGGGGAGGACTGCCCTTTGACATAGTTAAATCAGTGTTATAATGGGAAAGTTCTCTCTTTTTTCGCGGTTGTTTTTTTTATACATATATACATATCTCCAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGC
  3   1   3        nb Tad5      in                         XZT42877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAATTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATT
  3   1   3        nb Brn4 5g3  in                        CAAL23535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTGGTTAAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGTTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATAGGGGGCACAAACCCCCCCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGGGGATGACTGCCCTTTGACATAGTTAAATCAGTGTTATAATGGGAAAGTTCTCTCTTTTTTCGCGGTTGTTTTTTTTATACATATATACATATCTCCAAATATATATCGGGTTTAACTTATTTGTGCCCGTTCTGTAAAGCGGAGGGAAATCTGTGGGAATCCATCCAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAAGGAATAAAAAAGGTTTACCC
  3   1   3        nb Brn4 5g3  in                        CAAL23745.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAAACCAAAGAAAAAAAGAATCCCTTGTTAATGTTGGAAAATCCGGAAGGCTTTGTTTCTGTTTTTGCAGTCCTTTTGCCCCCAGGGAATTTTTTTTGTTTCCCCCCCAGGGAAAAATTGTGGGGGGTTCGGGGAATTTTGGGTTTCAGATTAATTTTGTAAACGGTTTTTGTTTTTTTTTTTGGTTAAGAGGAAAAAGCGGACTTTGGGCCGGGGGGGCCTGAAATTCCCTGCAACCGGCCCAGTTAATTTGGCGGGGGGTCTCCCCCCAAAAAAAAAGCAGGTTTTTTTTTTTTAAAAACATAGGGGGCCCAACCCCCCCCAAAAAAAAAAGGCTTTTCCGTTTAACTCCTCGTTTGCCCAAAGGGGGCTTTTGGGAAGTTTAAGGGAAACCCAAAAAAAAAATTTGGCGGGGGGGGGCGGCCCTTTGCCATGGTTAAACCGGGGTTTTAAGGGGAAAGTTCTCTCTTTTTTCGGGGGGGTTTTTTTTAAC
  3   1   3        nb Eye  5g3  in                         CCAX5587.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAAACAAAGAAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGGGCACAAACCCCCCCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   3        nb Tad5      in                         XZT57920.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACGGTTTTGGTTTTTATTTTTGGTTTAGAGGTAATAGCTGACTTTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGTTAATATTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGGGCACAAACCCCCCCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAAATTTAGCTGTGGATGACTGCCCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAGGTTTACCC
  5   1   3        nb Tad5      in                         XZT42877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAATTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACCAAAAAAAAAAAAAAAGG
  3   1   3        nb Brn4      in                        CAAL22367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   3        nb TpA       in                   TTpA066c14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAAAAAAAGAATCCCTTGATTATGTATGAAAATCACGAATGCAGGGTTACTGTCTTAGCAGTCCTTTTCCCCCCAAGGAATTATTTCGGTTTCCTTCCCAGAGAAAAATTGTGGGGGGTTCGGCGAATTTTCAGTCTCAGATTAATTTAGTAAACCGCTGGAGTTGGGATTCAGGGCTTAGATGAAAGAGCCGAGTTTGTACCAGGGGGGCGGACAACTCCGTGCAACCGACCCAGTTAATAATGCAGGGTGTCTACCTACATAAAAAAAGCACGTTTTATCTTTTTATATACATAGGGTGCACAAACACCGCCAAAAAAAAAAGACTTTTCCGTTCAATTACTAGTTTGCCCGAAAGAGGGCCCTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCGGTGGATGAGGGACCTTTGACATAGTTAAATCAGGGTTATAACGTGAAAGTTCTCTCCCTTTTCGGTGTTGTTTTTTTTATACATATAGACATATCTCCACATATACATTTGGTTTACCTTATTCGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTCGAATCCATACAGAATCTTCAGAAAGTTCTTGAGTTAAAAAAAATTTGGCAAAATGAATAAATAACGGGTTTAACCAAAAAAAAAAAAAAAAAAGC
  5   1   3        nb Tad5      in                         XZT57920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTA
  3   1   3        nb Tad5      in                          XZT5144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGAT
  3   1   3        nb TpA  FL   in                    TTpA004o21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACNCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCANAATAATTTTGCAAAATGAATAAAAAAAGATTAACCAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb TbA  5g3  in                    TTbA032j17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATGAAAATCATGAAGGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTTTGTTTCCCTCCCAGAAGAATAATTGTGGGGGGTTCGGAGAATTTTGTGTCTCAGATAAATTTTGTAAACAGTTTTTGTTTGTATTTTTTGTTAAGAGGTAAAAGATGACTCTGTGCCAGGGGGGCTGGCAAATCCCTGCAACCGACCCAGGTTAATACTGCAGCGTGTCTACCTACATAAAATAAGCAGGGGGGATGTTTTTATAAACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTAAATTAATCGTTTGCCCAAAGTGGGCATTTGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGAGGAAGACTGACCTGTGACATAGTTAAATCAGTGTAAAAATGAGAAAGTTCTCTCGTTTTTCGGGGGTGGTTTTTTTTTATACATATATACAGATCTACAAATATA
  3   1   3        nb Eye  5g3  in                         CCAX8647.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTCCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACCCCCCCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAACC
  3   1   2       ext Tad0 FL   in                    IMAGE:5381977.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGTTAATACTGCAGCGTGTCTCCCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAACCCCCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGCCCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATCCATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTACCCAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       add BrSp 5g3  in                     EC2BBA24BD09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTTCGTAGGCTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGATAATACTGCAGCGTGTCTACCTACATACAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAGACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGCTCTGTAAAGCG
  3  -1   3        nb TbA                             TTbA053o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTTTTTTTTTTTTTTTTTTTAAAATGTAAAACTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGGGCACAAACCCCACCAAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAAATTTAGCTGGGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGGGAAAGTTCCCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCGGGTTTAACTTATTTGGGACCGTTCTGTAAAGCGGAAAAAAATCTGTGAAAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAAT
  3   1   0       chi TbA       out                   TTbA037d16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGTTTTTATTTTTGGGGAAGAAGTAATAGCTGACTCTCCCCCAGGGGGGCGGGAAACTCCTTGCAACCGACCCAGATAATACTGCAGCGTGTTTACTCCCAGAAAATAAGCATGTTTTCTCTTTTTAAATACATAGGGGGCACAATCTCCTCCAAAAAAAAAAGACTTTTCCGTTTAAGGGCTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAACGCCAAAAAAAAATTTAGCTGGGGGTGATTGACCTCCGACCTAGTTAAATCAGTGTTATAAGGGAAAGTTTTTTCTTTTTTCGCCCGCCCCCTTTTTTATCCTTTTATACATATATACAAAAAAATATAGGGGAAACTTGTTTGTGACCGTTCGGTATTGCGCCGCGAAATAAAAAAAATCCAAACAGAATATAAAGAAAGATAAAGAGTTCCAAAAAAAGGGCAAAAGGAATAAAAAAAAATTAACCAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA  5g3  in                    THdA035o12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTTTTGTTTAGATGTAATAGCTGTCTCTGTACCAGGGGGGCATGCAACTCCCTGCAACCGACCCAGCTAATAATGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATATATTTTGCAAAATGAATAAAAAAAGATTACCAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb BrSp 5g3  in                    EC0CBA005DF01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAATCAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA  5g3  in                   TTpA067m03.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTA
  5   1   2  SIG                                  Xt7.1-EC2BBA18CE05.5                                                                                                 GCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAAC------------------------------------------------------------------------GCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAAACAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008273100                                                                                                       GTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAACCCCCCT------------------------------------------------------------TCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAAACAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed BrSp 5g3  in                     EC2BBA18CE05.g1                                                      GGGGAACAGAAGAAGTAAGCCTAGCTGCTTCTCAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGGCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTCCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAGATACAAATAAAGTTTCCCTTTCCTAAACCCCCCTT
  5   1   2       ext BrSp 5g3  in                     EC2BBA25AD06.g1                                                                                     GGAGAAAAGGAGGCGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCG
  5   1   3        nb BrSp 5g3  in                     EC2BBA30CD06.g1                                                                                                GGGGGGTGTAGGGGCTGAGAGTGTAGCATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGACAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGTGTAGCGGA
  5   1   2       ext BrSp 5g3  in                    EC0CBA005AF08.g1                                                                                                                        GGGATCCCATGCCTCTGTAGCACTGACACTGCCTGCCGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGGGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTCCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAAACCTGAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGGCACATCAGC
  5   1   3        nb BrSp 5g3  in                     EC2BBA29BA06.g1                                                                                                                                                          GGGGAGGGACCCCCTGTGAGCTTTGCATCTGAGCCCTCCTCTGCCTCATCTCCACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAATATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAAA
  5   1   3        nb BrSp 5g3  in                    EC0CBA003BD08.g1                                                                                                                                                                                                            GGGACACAGAGGAAGAAGAGAGGCAGATTTTCCTGTGAAGCTCAGGCAGCTTATTTTGCACAGGAAGCTGTAGCTGAAAAAAGAGAGGTCTTGGAAGACTGCAACAGATCAGAATGGATGTGCTTATGAAAGGCTTGTCCAAAGCAAAGGAAGGTGTGGTGGCTGCAGCCGAAAAGACTAAGCAAGGGGTAGCGGAGGCTGCAGAGAAAACCAAGGAAGGTGTTCTATATGTGGGAAGCAAAACCCGAGATGGAGTGGTGCAAGGAGTGGCTTCAGTGGCTGAAAAGACCAAAGAGCAGGCATCTCAGCTTGGGGGAGCCGTCATGTCTGGGGCTGGCAACATTGCTGCAGCTACTGGACTGGTGAAGAAGGATGAGTTCCCTACAGACATCAAGCCTGAAGAGGAGGCCCAGGAAGCCTTGGAAGAACCTGCAGCTGAGCCTCTCCTGGAACCTGAAGGAGAGAACTATGAAGAGGCCCCACAGGACGATTACCAGGAATATGAACCTGAAGCATAACAACCCAGTATTTCGGGCCCCTCCACCAGCAACATCAGCACAAAGATAGCTATAATGAAAAAAAAGA
  3   1   2       ext BrSp 5g3  in                     EC2BBA25AD06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATAATGTGAGAATCCATACAGAATCTTTTGAA
  3   1   3        nb BrSp 5g3  in                     EC2BBA29BA06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTCGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTAAATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGAGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTCTTGTGTTCCAAATAAT
  3   1   3        nb BrSp 5g3  in                     EC2BBA30CD06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTCACCTGCAGAGAACCTCATGTGAAGTGATTTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATAATGTGAGAATCCATACAGAATCTTTTGAA
  3   1   4      seed BrSp 5g3  in                     EC2BBA18CE05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTATGTATGGTAACCCTTAGCGTTGAGTCATAGTCCAAGCAAAAATGGATGTTTAAAACAAAGAAAAAAAGAATCCCTCGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCTCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTCTTGTGTTCCAAATAAT
  3   1   3        nb BrSp      in                     EC2BBA12DB06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGAAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAA
  5   1   3        nb BrSp      in                     EC2BBA12DB06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAAAAAAAAGAATCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTTGAATGTTCTT
  3   1   2       ext BrSp 5g3  in                    EC0CBA005AF08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCCTTGATAATGTATGAAAATCATGAATGCATTGTTACTGTCTTTGCAGTCCTTTTGCCCCCAAGGAATTATTTCTGTTTCCCTCCCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTACATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAAACAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb BrSp 5g3  in                    EC0CBA003BD08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGAGAATAATTGTTGGGGGTTCGGTGAATTTTGTGTCTCAGATTAATTTTGTAAACTGTTTTTGTTTTTATTTTTTGTTTAGATGTAATAGCTGACTCTGTGCCAGGGGGGCCTGCAACTCCCTGCAACCGACCCAGCTAATACTGCAGCGTGTCTACCTAAATAAAATAAGCATGTTTTATCTTTTTATATACATATGGTGCACAAACACCACCAAAAAAAAAAAGACTTTTCCGTTTAACTACTCGTTTGCCCAAAGTGGCATCTTTTGGGCATTCGTGAAGTTTAAAGGAAAGCCAAAAAAAAATTTAGCTGTGGATGACTGACCTTTGACATAGTTAAATCAGTGTTATAATGTGAAAGTTCTCTCTTTTTTCGCTGTTGTTTTTTTTATACATATATACATATCTACAAATATATATCTGGTTTAACTTATTTGTGACCGTTCTGTAAAGCGGAGAGAAATCTGTGAGAATCCATACAGAATCTTTTGAATGTTCTTGTGTTCCAAATAATTTTGCAAAATGAATAAAAAAAGATTAAACAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)