Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

1% 1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBTA707.5                          4832 END     3           1        0                Hypothetical LOC496909 [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABG9955.3                          335 END     2           0        0                Hypothetical LOC496920 [Xenopus tropicalis]
     31.6699999999999999    0Xt7.1-CBTA4602.3                            3 END     3           1      100                Hypothetical LOC496920 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     41739.0    0Xt7.1-CABK3439.3.5                        568 PI      96          2     1013                Hypothetical LOC496920 [Xenopus tropicalis]
     51750.0    0Xt7.1-CABG9955.3                          335 PI      97          8     1013                Hypothetical LOC496920 [Xenopus tropicalis]
     6 720.0    0Xt7.1-CAAP1601.3                           89 PI      82         12      788                Hypothetical LOC496697 [Xenopus tropicalis]
     7 697.0    0Xt7.1-CABK1302.3                           51 PI      82         12      788                Hypothetical LOC496633 [Xenopus tropicalis]
     8 446.0    0Xt7.1-CBTA4602.3                            3 PI      90        394      717                Hypothetical LOC496920 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012070529 Xt7.1-CBTA4812.5 - 239 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              4     5    49    50    60    62    75    77    88    88    97    97   102   102   107   107   109   109   110   110   114   115   116   117   117   119   119   122   123   125   127   127   127   130   132   135   137   138   153   154   155   158   158   160   163   164   171   171   178   178   184   184   186   186   195   197   197   200   202   202   210   210   212   212   214   215   215   215   217   217   220   220   220   220   218   220   221   222   222   223   225   225   227   227   227   227   226   228   229   229   222   229   226   228   227   230   229   231   228   231   230   231   227   230   227   229   215   227   226   226   226   228   222   227   224   226   222   225   222   224   204   211   201   206   191   199   192   194   176   185   169   180   175   180   172   176   163   168   160   164   154   163   155   159   155   157   138   155   148   150   136   148   136   142   120   130   112   124   121   122   118   120    93   117    87   116    82   103    17    34     3     6     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTTACAAACAATTAAATTGATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGGCATCAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T----T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------AT--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------G--
                                               BLH ATG      33     615                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      33      94                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      33     102                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       3      71                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      33       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Ci ---- 7e-030     CAD24308.1 putative coagulation serine protease [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Br ---- 4e-032     AAQ96651.1 elastase I [Branchiostoma belcheri tsingtaunese] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bb ---- 2e-032     BAC75886.1 mannose-binding lectin associated serine protease-1 [Branchiostoma belcheri] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 2e-033     NP_501379.1 serine protease 22D (4I977) [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 2e-036     NP_611066.1 CG8299-PA [Drosophila melanogaster] --===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 1e-038     XP_001201324.1 PREDICTED: similar to LOC561562 protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 2e-068     XP_001231334.1 PREDICTED: similar to trypsinogen [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 2e-070     NP_002762.2 mesotrypsin preproprotein; trypsin 4, brain; protease, serine, 4;mesotrypsinogen; trypsin 3; brain trypsinogen; pancreatic trypsinogen III [Homosapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 7e-071     NP_076196.1 RIKEN cDNA 1810009J06 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Dr ==== 1e-077     XP_696150.1 PREDICTED: similar to Anionic trypsin II precursor (Pretrypsinogen II) [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 3e-117     AAH78492.1 MGC85264 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 3e-117     NP_001087272.1 MGC85264 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Xt ==== 1e-151     AAH88079.1 Hypothetical LOC496920 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBTA4812.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGATGATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------TGA---------ATG------------------------------------------------------------TGA------------TGA---------------------------------------------------ATG------TAG---------------------TAA------ATG---------------------------------ATG---------------------------------------------------------TAA---TGA---------------ATG---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld Abd0 5g                            IMAGE:7002955                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGTGACTATANAACATGTTTGTGGCCCAGTATTCCGCGGTGATCTGACGCCCCACGAGAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCCGTTTCAGGGTGGGGAGCTACTGTATATTTAGAATTCTCCAGATGTATGTTTATTTG
  5   1   2   10  bld Spl2 5g3  in                        CBSS8311.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTCAGCTTACGACTGACAACCCAAGAAAACTCATCATGATGCCTCTCTGGGTACTGATGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAGGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAAAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCACCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTACTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACT
  5   1   2   10  bld Spl2 5g3  in                        CBSS8397.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTCAGCTTACGACTGACAACCCAAGAAAACTCATCATGATGCCTCTCTGGGTACTGATGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAGGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAAAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCACCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTACTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAG
  5   1   2   10  bld Panc 5g3  in                        CBTA1148.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTCAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCT
  5   1   2   20  bld Panc 5g   ?                         CBTA3567.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTCAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCT
  5   1   2   10  bld Panc 5g3  out                        CBTA2895.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTC
  5   1   2   10  bld Panc 5g3  in                        CBTA3332.fwd ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGA
  5   1   2   10  bld Spl2 5g3  in                        CBSS5669.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTACGACTGACAACCCAAGAAAACTCATCATGATGCCTCTCTGGGTACTGATGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAGGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAAAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCACCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTACTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGC
  5   1   2   10  bld Panc 5g3  in                        CBTA3442.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTC
  5   1   2   10  bld Panc 5g3  in                        CBTA3704.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACT
  5   1   2   10  bld Panc 5g3  in                        CBTA5161.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTG
  5   1   2   10  bld Panc 5g3  in                         CBTA5833.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTT
  5   1   2   20  bld Panc 5g                              CBTA6475.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCT
  5   1   2   20  bld Panc 5g                             CBTA3778.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAG
  5   1   2   10  bld Panc 5g3  in                        CBTA1400.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTAC
  5   1   2   20  bld Panc 5g                             CBTA2187.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGA
  5   1   2   20  bld Panc 5g                              CBTA2823.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATT
  5   1   2   20  bld Panc 5g                              CBTA2908.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATAT
  5   1   2   10  bld Panc 5g3  in                        CBTA3735.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGC
  5   1   2   10  bld Panc 5g3  in                         CBTA418.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGAC
  5   1   2   10  bld Panc 5g3  in                        CBTA4192.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAAT
  5   1   2       bld Panc      out                       CBTA4602.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAAT
  5   1   2   10 seed Panc 5g3  in                        CBTA4812.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTG
  5   1   2   10  bld Panc 5g3  out                       CBTA4933.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATAC
  5   1   2   30  bld Panc 5x3                             CBTA502.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAATCACTAGACACAAACCCTTGAGACTCACATA
  5   1   2   10  bld Panc 5g3  in                        CBTA5202.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAA
  5   1   2   10  bld Panc 5g3  in                        CBTA5680.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAA
  5   1   2   10  bld Panc 5g3  in                         CBTA6368.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTC
  5   1   2   10  bld Panc 5g3  in                         CBTA6398.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGT
  5   1   2   20  bld Panc 5g                              CBTA782.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCT
  5   1   2       bld Abd0 5g3  in                     IMAGE:6999149.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTACGACTGACAACCCAAGAAAACTCTTGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTNAAGTCTGTAACTATCTAGACTGGATAANGATA
  5   1   2       bld Abd0 5g                            IMAGE:7015731                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCT
  5   1   2       bld AbdN FL                            IMAGE:7024962                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCCTTGAGACTCACATACAGTGACTGTATACCATGGGGAAGCATGTGGCTCTTCTGC
  5   1   2   10  bld Bone 5g3  in                        CBTC2371.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAA
  5   1   2   10  bld Panc 5g3  in                        CBTA1015.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCT
  5   1   2   20  bld Panc 5g                             CBTA3658.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATT
  5   1   2   10  bld Panc 5g3  in                         CBTA804.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAG
  5   1   2   10  bld Panc 5g3  in                         CBTA872.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACA
  5   1   2   10  bld Panc 5g3  in                         CBTA3061.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TACGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATAT
  5   1   2   10  bld Panc 5g3  in                        CBTA1866.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACT
  5   1   2   10  bld Panc 5g3  in                        CBTA3682.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATT
  5   1   2   20  bld Panc 5g                             CBTA4591.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAA
  5   1   2   20  bld Panc 5g                             CBTA4991.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAC
  5   1   2   20  bld Panc 5g                              CBTA2816.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACT
  5   1   2   10  bld Panc 5g3  in                        CBTA3524.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAAC
  5   1   2   30  bld Panc 5x3                             CBTA596.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACT
  5   1   2   10  bld Panc 5g3  in                         CBTA696.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAA
  5   1   2   10  bld Panc 5g3  in                        CBTA3557.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCATTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGAC
  5   1   2   10  bld Panc 5g3  in                        CBTA5326.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCANGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAANGTGAAAAGGGTTCTTGCANGGGTGACTCTG
  5   1   2   20  bld Panc 5g   ?                          CBTA5922.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTA
  5   1   2   10  bld Panc 5g3  in                        CBTA3417.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGT
  5   1   2   10  bld Panc 5g3  in                        CBTA5722.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATG
  5   1   2       bld Abd0 5g3  in                       IMAGE:7003362                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCCTTGAAGACTCACATAACAGTGAA
  5   1   2   20  bld Panc 5g                              CBTA896.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTC
  5   1   2       bld Sto1      in                        CABG11155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACACAGCTCCCACATCTTTATCCTGTAT
  5   1   2   10  bld Panc 5g3  in                        CBTA4629.fwd ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAAT
  5   1   2   10  bld Panc 5g3  in                         CBTA5905.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTT
  5   1   2   10  bld Panc 5g3  in                        CBTA1388.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAACTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGATTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGAC
  5   1   2       bld Panc      out                        CBTA5869.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAA
  5   1   2   10  bld Panc 5g3  in                         CBTA758.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCCAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACA
  5   1   2   10  bld Panc 5g3  in                        CBTA1678.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGNCATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTC
  5   1   2   30  bld Sto1 5g                             CABG12436.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCCACATCTTTAATCTGTAT
  5   1   2       bld Sto1      in                        CABG10980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTA
  5   1   2   10  bld Panc 5g3  in                        CBTA4002.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAA
  5   1   2   10  bld Panc 5g3  in                         CBTA6469.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAACTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATAC
  5   1   2   10  bld Spl1 5g3  in                         CABK3598.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTG
  5   1   2   30  bld Panc 5x3                            CBTA4758.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGC
  5   1   2   20  bld Panc 5g                              CBTA6135.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGA
  5   1   2       bld Sto1      in                         CABG1654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAATTCGGCACGAGGCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGG
  5   1   2       bld Spl1      in                         CABK6104.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCGATTCGTGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGATTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATC
  5   1   2       bld Abd0 5g                            IMAGE:7018243                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGATATTAC
  5   1   2   10  bld Panc 5g3  in                        CBTA4450.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATAC
  5   1   2       bld Sto1      in                         CABG2309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAAT
  5   1   2       bld Sto1      in                         CABG9908.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAAACATCATATATGTGTATTACTGTGTGTGC
  5   1   2       bld Spl1      in                         CABK2853.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATC
  5   1   2       bld Panc                                CBTA5199.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAANGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGTGAAAAGGGTTCTTGCANGGGTGACT
  5   1   2       bld Spl1      in                         CABK2506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGATTCGCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAAACATCATATATGTATTTTACTGTGTGTGC
  5   1   2       bld Spl1                                 CABK5615.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCGATTCGTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGC
  5   1   2       bld Spl1      in                         CABK9874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAC
  5   1   2       bld Panc                                CBTA3216.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAAC
  5   1   2       bld Spl1      in                         CABK2839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTG
  5   1   2       bld Spl1                                 CABK2893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGCCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGGACATCAATATATGTA
  5   1   2       bld Sto1      in                         CABG2572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGGAAGCATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTNTATCCTGTAT
  5   1   2       bld Sto1      in                         CABG2906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCTCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTG
  5   1   2       bld Sto1      in                         CABG3793.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAANACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGGAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTTATCTGTATGAAATATCATATCTTTGACAT
  5   1   2       bld Spl1      in                        CABK11053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGNGAAGCAATGTGGCTCTTCTGCTGCAGCTG
  5   1   2       bld Spl1      in                         CABK7702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAAACATCATATATGTATTTTACTGTGTGTGCAG
  5   1   2       bld Sto1      in                         CABG1645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGGTACTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCA
  5   1   2       bld Sto1      in                        CABG10960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGNGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACAT
  5   1   2       bld Abd0      in                     IMAGE:6999195.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATACAGNAAACACTAGACACAATCCTTGAGACTCACATACG
  5   1   2       bld Panc      ?                          CBTA6133.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGG
  5   1   2       bld Int1                                 CAAP6438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGNGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATC
  5   1   2       bld Sto1      in                         CABG6413.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACT
  5   1   2       bld Spl1                                 CABK2157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAG
  5   1   2       bld Spl1      in                          CABK422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAAACACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTTGACATCAATATATGTATTTTACT
  5   1   2       bld Spl1      in                         CABK7417.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAAACATCATATATGTATTTTACT
  5   1   2       bld Spl2      in                        CBSS2854.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTTCCTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGANAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGNGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAAT
  5   1   2       bld Spl1      in                         CABK3090.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACA
  5   1   2       bld Sto1      in                         CABG6927.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGNGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCCACATCTTTATCCTGTAT
  5   1   2       bld Panc      in                        CBTA5327.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTA
  5   1   2       bld Int1      in                         CAAP9334.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTTGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAAACATCATATATGTATTTTACT
  5   1   2       bld Int1      in                        CAAP10358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCCTTGAGACTCACATACAGTGACTGTATACCAT
  5   1   2       bld Sto1      in                        CABG10968.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTTATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGC
  5   1   2       bld Sto1      in                         CABG6305.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACT
  5   1   2       bld Spl1      in                         CABK9010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTGCTGCTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGNGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTG
  3  -1   2       bld Spl1      in                         CABK2720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGAGAGGCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATG
  5   1   2       bld Spl1      in                         CABK4071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCTCTGGATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAA
  3   1   2       bld Sto1      in                         CABG2906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGATGATGATAAGATGTGGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAGCCTCTCGCC
  5   1   2       bld Spl1      in                         CABK5326.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGATGATGATAAGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATT
  3  -1   2       bld Spl1      in                         CABK7991.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGATTGTGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAANTATGTGTTCTAGCTGTTATATGCTATAAACATTAAATTGATATGAGGCATCAGAAAAAAAAAA
  3   1   2       bld Sto1      in                        CABG10960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAAAAAAAAAAGCCTCTCG
  5   1   2       bld Spl2                                CBSS4349.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAGGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAAAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCACCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTACTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTAT
  5   1   2       bld Int1      in                         CAAP8128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTA
  3   1   2       bld Abd0 5g3  in                       IMAGE:7003362                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGTGGCACCCCTTCACTTCCCAGNCCNTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGGTGTGGGGGGTTCCCTAATTTCACCCANGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATG
  5   1   2       bld Panc      out                        CBTA6395.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATATGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAAC
  5   1   2       bld Liv1      in                         CAAR7709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGCACCCCTCACTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCCAAAG
  3   1   2       bld Sto1      in                        CABG11155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCTCATTCCCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAGTCAAAAAAAAAAA
  3  -1   2       bld Sto1      in                        CABG12562.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGCCCTGGCAAGTATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGNGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTG
  3   1   2       bld Spl1      in                         CABK7417.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCCCTGGCAAGTATTGTTCACCTTCATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCG
  5  -1   2       bld Sto1      in                        CABG12562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGTATGTTCACCTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATCCTCGG
  3   1   2       bld Spl1      in                         CABK2839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTATTGTTCACCTTCAATGAAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAGC
  3   1   2       bld Spl1      in                         CABK2853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGTTCACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAAAAA
  5   1   2       bld Panc      out                        CBTA451.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACCTTCAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCA
  3   1   2       bld Sto1      in                        CABG10980.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTC
  3   1   2       bld Spl1      in                         CABK4071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATGGAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATATTTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGC
  3   1   2       bld Spl1      in                         CABK2506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Spl1      in                         CABK9010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAACTGGTGTGGGGGTTCCCTAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Spl1      in                         CABK3090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGTTCCCTATTTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTC
  3   1   2       bld Int1      in                         CAAP8128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTTCCCTATTTCACCCAGATGGATAATTTCTGCTGCTCATGNCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAAAAAAA
  3   1   2       bld Spl1      in                        CABK11053.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCCTAATTTCACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGC
  5  -1   2       bld Spl1      in                         CABK2720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATTTCACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGCAAA
  3   1   2       bld Sto1      in                         CABG2309.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGC
  3   1   2       bld Sto1      in                         CABG6413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCAGATGGATTATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAGTCCT
  3   1   2       bld Spl1      in                         CABK9874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAGATGGATAATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGC
  3   1   2       bld Abd0 5g3  in                       IMAGE:6999149                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCACCCAGATGATAAATTCTGCTGCTCATGCTACCAGCCACCCAAGACNTTGGTGCTCTCCTTGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATAAATGATTG
  3   1   2       bld Sto1      in                         CABG3222.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTTCTGCTGCTCATTGCTACCAGCCACNCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGG
  5   1   2       bld Sto1      in                         CABG3222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTNGTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGTGAAAAAAAAAAAAAAAAA
  5   1   2       bld Panc      in                         CBTA980.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCTAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc 5g3  in                         CBTA418.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  5   1   2       bld Panc                                CBTA5730.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTT
  3   1   2       bld Spl1      in                         CABK5326.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGC
  3   1   2       bld Sto1      in                         CABG1645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACNCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAAAAAAA
  3   1   2       bld Sto1      in                         CABG1654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGC
  3   1   2       bld Sto1      in                         CABG3793.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAAAAAAA
  3   1   2       bld Sto1      in                         CABG6305.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGC
  3   1   2       bld Sto1      in                         CABG6927.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Spl1      in                          CABK422.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Spl1      in                         CABK7702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  5  -1   2       bld Spl1      in                         CABK7991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTATAAACAATTAAATTGATATGAGGCATCAG
  3   1   2       bld Spl1      out                        CABK9729.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Sto1      in                        CABG10968.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGTGC
  3   1   2       bld Panc 5g3  in                        CBTA4629.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTCATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGC
  3   1   2       bld Panc 5g3  in                        CBTA4812.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTGCTACCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTAAAAAAAAAAAAAA
  3   1   2       bld Panc      in                         CBTA980.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTGCTACCAGCCACCCAAGACNTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCTAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATC
  5   1   2       bld Panc      in                         CBTA487.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACNGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Sto1      in                         CABG4169.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATC
  5   1   2       bld Sto1      in                         CABG4169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCCACCCAAGACCTTGGTTGCTCACCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCANAAAAAAAAAAAAAAAA
  5   1   2       bld Sto1      in                         CABG7824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCCACCCAAGACCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAAA
  5   1   2       bld Sto1      in                        CABG10387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAGGCTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCANAAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                        CABG10387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTGGTTGCTCTCCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc 5g3  in                        CBTA1388.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGATTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTC
  3   1   2       bld Panc      in                         CBTA487.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCT
  3   1   2       bld Panc 5g3  in                        CBTA5202.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc 5g3  in                        CBTA3682.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCT
  3   1   2       bld Panc                                CBTA3686.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Spl2 5g3  in                        CBSS8397.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACACGATCTTAAAAAAAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCACCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTACTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACTAACAATTAAATTGATAGGAGGCATCAATCTT
  5   1   2       bld Panc      in                         CBTA449.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACT
  3   1   2       bld Panc 5g3  in                         CBTA696.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGTGC
  3   1   2       bld Panc 5g3  in                        CBTA1400.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACACGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc 5g3  in                         CBTA804.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGATCTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGGGGCATC
  3   1   2       bld Panc 5g3  in                        CBTA1866.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGTGC
  3   1   2       bld Sto1      in                         CABG7824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Sto1      in                         CABG2572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCTTC
  3   1   2       bld Sto1      in                         CABG9908.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGATTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCTTC
  3   1   2       bld Spl1 5g3  in                         CABK3598.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc 5g3  in                         CBTA5905.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGCAAAAAAAAAAAAAAA
  3   1   2       bld Bone 5g3  in                        CBTC2371.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGTAC
  3   1   2       bld Panc 5g3  in                         CBTA3061.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGAAGGAAGGAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAA
  3   1   2       bld Panc 5g3  in                         CBTA6469.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGCAAAAAAAAAAAAAAA
  5   1   2       bld Panc      in                        CBTA5228.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAG
  3   1   2       bld Spl2 5g3  in                        CBSS5669.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGCAGCACATCCAAGTGGAGGCCACCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTACTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACTAACAATTAAATTGATAGGAGGCACC
  5   1   2       bld Panc      in                        CBTA2343.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc      in                        CBTA2343.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc 5g3  in                         CBTA758.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGATTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACTAACAATTAAATTGATATGAGGCATCAATCCT
  3   1   2       bld Spl2 5g3  in                        CBSS8311.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGGAGGCCACCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTACTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACTAACAATTAAATTGATAGGAGGCATCAATCCT
  3   1   2       bld Panc 5g3  in                         CBTA6368.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAA
  3   1   2       bld Panc 5g3  in                         CBTA6398.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGAGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAA
  5   1   2       bld Panc      in                         CBTA5927.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGCCAATCTGGCCCGGACGCGTGGGCAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGC
  3   1   2       bld Panc 5g3  in                        CBTA5722.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCT
  3   1   2       bld Liv1      in                         CAAR7709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGATTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGGGTGGGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGGGGCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5  -1   2       bld Panc      out                       CBTA2280.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGATTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGGGGCTTC
  3   1   2       bld Panc 5g3  in                        CBTA3417.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTTTGGAAGTGCCCATTGTTTTTGACTCCAGCTGTAAGGTTTCATATCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGGGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTTTCCAGGAGTGTATGCTAAAGTCTGTAACTATTTGGACTGGATAAAGAATATTACGGAAAACAATTGGACACAAACCCTTGGGATTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGTTTTTTTGTTGCAGTTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATATCATTTTTTGAACATCAATATATGTATTTTACTGGGTGGGCAGCCCCCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTCCAAACAATTAAATTGATATGGGGCTTC
  3   1   2       bld Panc 5g3  in                        CBTA3557.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGCCTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCATTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGATTTTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTTTCCAGGAGTGTATGCTAAAGTCTGTAACTATTTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGTTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGGGGCTTC
  3   1   2       bld Sto1      in                         CABG6675.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATC
  5   1   2       bld Sto1      in                         CABG6675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Panc 5g3  in                        CBTA4192.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATAAGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCT
  3   1   2       bld Panc      in                         CBTA5927.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCCCGGACGCGTGGGCAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                         CABG4176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  5   1   2       bld Sto1      in                         CABG4176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCACTTTGGCTACAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Panc 5g3  in                        CBTA4002.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTTTGGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGC
  3   1   2       bld Panc 5g3  in                        CBTA3524.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTTTGGAAGTGCCCATTGTGTTTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTTTCCAGGAGTGTATGTTAAAGTCTGTAACTATTTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGTTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATATCATTTTTTGAACATCAATATATGTATTTTACTGTGTGGGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGGGGCTTC
  3   1   2       bld Panc 5g3  in                        CBTA5680.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc 5g3  in                         CBTA872.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGTTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGATTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATCCCATGGGAAGCAATGTGGTTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTG
  3   1   2       add Panc 5g3  in                        CBTA3332.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCCATGATATCATGTTGGTTAAACTAGCGAAACCTGTTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTTTTTAGTTTCTGGCTATGGGAATGTGCTTGGATATAATACGGGATACCCTGATCAACTGCAGTTTTTGGATGTGCCCATTGTTTTTGACTCCAGCTGTAAGGTTTCATTTCCCGGGATGATTTTTGAGAACATTTTTTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTTTTGCAAGGGTGATTTTGGGGGCCCCCTGATTTGCAATGGGGAACTTTATGGGGGGGTTTCATGGGGGGGAAGTTACTGTTTCAGTAAGAATTTTCCAGGGGTGTATGTTAAAGTTTGTAACTTTTTGGACGGGATAAAGAATTTTCCGGAAAACAATTGGACCCAAACCCTTGGGATTCACATACAG
  3   1   2       bld Panc 5g3  in                        CBTA1678.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGATTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       add Panc 5g3  in                        CBTA3735.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGAGGGGGCTAAGTGTTTAGTGTTTGGCTATGGGAATGTGCTTGGATATAATACGGGATACCCTGATCAACTGCAGTGTTTGGAAGTGCCCATTGTGTTTGACTCCAGCTGTAAGGTTTCATTTCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGTTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGGGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGGGGTTTCATGGGGGGGAAGATACTGTTTCAGTAAGAATTTTCCAGGAGTGTATGTTAAAGTTTGTAACTTTTTAGACTGGATAAAGAATTTTACGGAAAACAACTGGACACAAACCCTTGGGATTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGTTTTTTTGTTGCAGTTGAACAACAGCTCCCAACATTTTTTTCCTGTATGAAATTTCATTTTTTGAACATCAATATATGTATTTTACTGGGGGGGCAGCCCCCAAAAGGGGTTAAATATGTTGTTTTAGCTGTTACAAACAATTAAATTGATATGGGGCTTC
  3   1   2       bld Panc 5g3  in                        CBTA3442.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTTTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTTTCCAGGAGTGTATGTTAAAGTCTGTAACTATTTAGACTGGATAAAGAATATTACGGAAAACAACTGGACACAAACCCTTGAGATTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGTTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATATCATTTTTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGGGGCTTC
  3   1   2       bld Int1      in                         CAAP9334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGGGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTTTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTCTGGGGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGGGGTTTCATGGGGGGGAAGATACTGTTTCAGTAAGAATTTTCCAGGAGGGTATGCTAAAGTCTGTAACTTTTTAGACGGGATAAAGAATTTTACAGAAAACAACTGGACCCAAACCCTTGAGACTCACATACAGGGACTGTATCCCATGGGAAGCAATGTGGTTTTTTTGCTGCAGTTGAACAACAGCTCCCAACATTTTTTTCCGGTATGAAATATCATTTCTTGAACATCAATATATGTATTTTACTGGGGGGGCAGCCCCCAAAAGGGGTTAAATATGTTGTTCTAGCTGTTATATGCTCCAAACAATTAAATTGATTTGGGGCTTC
  3   1   2       bld Panc 5g3  in                        CBTA4450.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTTTGGAAGTGCCCATTGTGTTTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGGGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTTTCCAGGAGTGTATGCTAAAGTCTGTAACTATTTAGACTGGATAAAGAATATTACGGAAAACAACTGGACCCAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGTTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATATCATTTTTTGAACATCAATATATGTATTTTACTGGGTGGGCAGCCCCCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTCCAAACAATTAAATTGATTTGGGGCTTC
  3   1   2       bld Panc 5g3  in                        CBTA5161.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTTTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTTTGGAAGTGCCCATTGTGTTTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGGGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTTTCCAGGAGTGTATGCTAAAGTCTGTAACTATTTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGTTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATATCATTTCTTGAACATCAATATATGTATTTTACTGGGTGGGCAGCCCCCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATTTGGGGCTTC
  3   1   2       bld Int1      in                        CAAP10358.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACA
  3   1   2       add Panc 5g3  in                        CBTA3704.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATATCATGTTGGTTAAACTAGGGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGGTAAGTGTTTAGTGTTTGGCTATGGGAATGTGCTTGGATATAATACGGGATACCCTGATCAACTGCAGTGTTTGGAAGTGCCCATTGTGTTTGACTCCAGCTGTAAGGGTTTATATCCCAGGATGATTTTTGGGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGGGGCCCCCTGATTTGCAATGGGGAACTTTTTGGGGGGGTTTCATGGGGGGGAAGATACTGTTTCAGTAAGAATTTTCCAGGGGGGTATGGTAAAGTTTGTAACTTTTTGGACTGGATAAAGAATTTTTCAGAAAACAACTAGACCCAAACCCTTGGGACTCACATACAGGGGCTGTATACCATGGGAAGCAATGTGGTTTTTTTGTTGCAGGTGAACAACAGCTCCCAACATTTTTTTCCTGTTTGAAATATCATTTTTTGAACATCAATATATGTATTTTACTGGGGGGGCAGCCCCCAAAAGGGGTTAAATATGTTGTTTTAGCTGTTATATGCTACAAACAATTAAATTGATTTGGGGCTTCGG
  3   1   2       bld Spl1      in                         CABK9185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAGT
  5   1   2       bld Spl1      in                         CABK9185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGAGGCATCAGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS2854.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACTAGCGAAACCTGCTCAGTATAATCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTTTGAGAACATGTTTTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTTTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTTTCTAGACTGGATAAAGAATTTTCCAGAAAACAACTAGACCCAAACCCTTGAGACTCACATACAGTGACTGTATCCCATGGGAAGCAATGTGGTTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATATCATTTCTTGAACATCAATATATGTATTTTACTGGGGGGGCAGCCCCCAAAAGGGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGGGGCCTC
  5   1   2       bld Panc      in                        CBTA5427.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc      in                        CBTA5427.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGTATGTGCAGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Sto1      in                         CABG1553.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAT
  5   1   2       bld Sto1      in                         CABG1553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK6104.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCATCCCAGTGGCAAGAAGCTGCCCAACAGACGGGGCTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGATTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGTGCAAATATTGTCTTTAATGTATTTGGCTAATAGGGGCTTTTACTGCAGTGCTGTCAAACAGAGCTGGGGCTTACAGTAAAGATGAAGGAATCACAAGGTGATGCACTCTGATGTTCTCTTGGATATTCTAgttaaagtagaaggaaaagtaaaaactaagtaaactttatcagaaaggtctatgtaaatacaagccataagcacttacagtaatgctccactgagtcctctattaaaagaaacacgGG
  5   1   2       bld Spl1      in                         CABK3558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCGATTCGTAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK3558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAGTGTCTAGTGTCTGGCTATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Abd0      in                       IMAGE:6999195                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGTGTCTGGCTATGAGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGTGCAAATATTGTCTTTAATGTATTTGGCTAATAGGGGCTTTTACTGCAGTGCTGTCAAACAGAGCTGGGGCTTACAGTAAAGATGAAGGAATCACAAGGTGATGCACTCTGATGTTCTCTTGGATATTCTAAAGaaagtagaaggaaaagtaaaaactaagtaaacttttttaaaggggtctatgtaaatcaagccataagcacttacagTAAGCTCCACTGATCCTCTATTAAAAAAAA
  3   1   2       add Panc      in                        CBTA5327.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTATGGGAATGTGCTTGGATATAATACGGGATACCCTGTTCAACTGCAGTTTTTGGAAGTGCCCATTGTTTTTGACTCCAGCTGTAAGGTTTCATATCCCAGGATGATTTTTGAGAACATTTTTTGTCCCGGTTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGGGGCCCCCTGATTTGCAATGGGGAATTTTATGGGGGGGTTTCATGGGGGGGAAGATACTGTTTCAGTAAGAATTTTCCAGGAGTGTATGCTAAAGTTTGTAACTTTTTGGACGGGATAAAGAATTTTCCGGAAAACAATTGGACCCAAACCCTTGGGATTCACATACAGGG
  3   1   2       bld Panc 5g3  in                        CBTA1148.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGGGAATGTGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGATTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGTTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTACAAACAATTAAATTGATATGGGGCATC
  5   1   2       bld Panc      in                         CBTA547.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGC
  3   1   2       bld Panc      in                         CBTA547.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTGGATATAATACGCGATACCCTGATCAACTGCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGGC
  3   1   2       bld Panc 5g3  out                       CBTA1443.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTGCAGTGTCTGGATGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAGTCCTATGTGCAAATATTGTCTTTAATGTATTTGGCTAATAGGGGCTTTTACTGCAGTGCTGTCAAACAGAGCTGGGGCTTACAGTAAAGATGAAGGAATCACAAGGTGATGCACTCTGATGTTCTCTTGGATATTCTAGTTAAAGTAGAAGGAAAAGTAAAAACTAAGTAAACTTTATCAGAAAGGTCTATGTAAATACAAGCCATAAGCACTTACAGTAATGCTCCACTGAGTCCTCTATTAAAAGAAACACGGG
  3   1   2       bld Panc 5g3  in                        CBTA5326.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGTGTCTGGAAGTGCCCATTGTGTCTGACTCCAGCTGTAAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGAAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Sto1      in                         CABG7339.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATC
  5   1   2       bld Sto1      in                         CABG7339.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGGCTTCATATCCCAGGATGATTTCTGAGAACATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGGTTCTTGCAAGGGTGACTCTGGCGGCCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGCTACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTAATCTGTATGAAATATCATATCTTGAACATCAATATATGTGTATTACTGTGTGTGCAGCCACTAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGTTACTAACAATTAAATTGATATGAGGCATCAAAAAAAAAAAAAAAAAA
  3   1   2       add Panc 5g3  in                        CBTA1015.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCCCGGGATGTTTTTTGGGAACATTTTTTGTGCCGGTTTCCTGGAAGGTGAAAAGGGTTTTTGCAAGGGTGATTTTGGGGGCCCCCTGTTTTCCAATGGGGAATTTTTTGGGGGGGTTTCTTGGGGGGGAAGATTCTGTTTCAGTAAGATTTTTCCGGGGGGGTATGCTAAAGTCTGTAACTTTTTGGGCGGGGTAAAGATTTTTCCGGAAAACAATTGGCCCCAACCCCTTGGGATTCCCATCCGGGGGCTGTTTCCCCGGGGAAGCAATGTGGTTTTTTTGTTGCAGGTGAACAACAGCTCCCAACTTTTTTTTCCTGTTGGAAATTTCATTTTTTGACCCTCAATTTTTGTTTTTTTCGGGGGGGGCCCCCCCCAAAAGGGGTTAAATTTGTTTTTTTAGCTGTTTTTTGCTCCAACCAATTAAATTGTTTTGGGGCTTC
  3   1   2       bld Panc      in                        CBTA5228.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCCNTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc      in                         CBTA449.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCTGATTTGCAATGGAGAACTTTATGGAGCGGTTTCATGGGGGGGAAGATACTGTATCAGTAAGAATTCTCCAGGAGTGTATGCTAAAGTCTGTAACTATCTAGACTGGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTTTTTTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCCGTCCTT
  3   1   2       add Panc 5g3  in                         CBTA5833.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTGGATAAAGAATTTTACGGAAAACAACTAGACCCAAACCCTTGGGATTCACATACAGTGACTGTATCCCATGGGAAGCAATGTGGTTTTTTTGTTGCAGGTGAACAACAGCTCCCAACATTTTTATCCTGTATGAAATTTCATTTTTTGAACATCAATATATGTATTTTACTGGGGGGGCAGCCCCCAAAAGGGGTTAAATATGTTGTTTTAGC
  5   1   2       bld Panc      in                         CBTA621.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Panc      in                         CBTA621.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATC
  3   1   2       bld Spl1      in                         CABK2285.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTG
  5   1   2       bld Spl1      in                         CABK2285.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATAAAGAATATTACAGAAAACAACTAGACACAAACCCTTGAGACTCACATACAGTGACTGTATACCATGGGAAGCAATGTGGCTCTTCTGCTGCAGCTGAACAACAGCTCCCAACATCTTTATCCTGTATGAAATATCATATCTTGAACATCAATATATGTATTTTACTGTGTGTGCAGCCACCAAAAGTGGTTAAATATGTTGTTCTAGCTGTTATATGCTACAAACAATTAAATTGATATGAGGCATCAGTCCTATGTGAAAAAAAAAAAAAAAAAA

In case of problems mail me! (