Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-XZT47111.3                            4 END     2           1       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     21341.0    0Xt7.1-THdA023a09.3                        122 PI      81         59     1629                novel protein similar to catalase [Xenopus tropicalis]
     3 520.0    0Xt7.1-CABG9233.5                           67 PI      75        162     1208                Hypothetical LOC496897 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012070639 Xt7.1-CABK1024.3 - 190 ESTs
                                                                       ....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK1024.3                         TTCTGAGTCCAGAGCGCTAACGGGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAA
                                                  Xt7.1-CHK-1008221944                               GTCCAGAGCGCTAACGGGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAA
                                                      consensus depths                              3     4     4     6     8    10    16    18    21    22    23    24    26    27    34    35    42    45    46    49    48    51    49    52    49    52    50    53    52    53    52    53    53    53    53    53    53    53    53    53    53    53    54    54    54    54    54    54    54    55    54    55    54    55    56    57    57    57    56    57    56    57    56    57    55    57    55    58    56    58    59    61    59    61    59    61    60    63    60    63    61    64    63    65    65    67    65    67    64    67    67    70    67    70    67    70    68    71    69    72    70    73    70    74    70    74    71    77    73    76    73    76    72    75    72    75    71    76    70    75    68    74    64    73    62    72    62    72    62    73    64    75    64    74    64    74    65    75    65    75    65    77    62    74    59    75    61    75    49    66    50    63    47    58    43    57    44    55    44    53    44    51    42    48    40    47    41    47    40    44    40    44    40    44    41    44    41    44    41    44    41    44    40    43    40    42    38    40    38    40    38    40    40    41    40    42    40    42    40    42    41    43    40    43    38    43    38    43    38    42    37    42    36    42    35    41    33    41    33    43    32    42    34    43    31    42    31    42    34    46    34    48    37    50    39    53    37    57    48    64    52    70    55    69    56    73    63    79    65    81    66    81    73    84    79    92    78    90    80    92    83    96    86    97    84    96    86    96    86    96    85    95    86    95    86    96    85    96    83    93    84    93    83    91    83    90    85    92    85    92    83    90    80    89    83    89    83    89    83    88    85    89    85    89    85    89    87    92    89    92    88    91    87    88    85    88    86    88    85    87    85    87    86    87    85    87    84    86    84    86    83    85    83    84    83    84    83    84    83    84    84    85    84    85    83    85    84    84    82    82    82    82    81    82    81    82    81    82    81    82    79    82    78    81    77    80    76    79    75    78    73    77    70    73    67    69    60    66    50    60     5     8
                                                                   SNP                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                             -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------GT
                                               BLH ATG      29    1577                         
                                               BLH MIN      29     295                         
                                               BLH MPR      29     295                         
                                               BLH OVR      29      27                         
                                               EST CLI      63      15                         
                                               ORF LNG      29       4                         
                                                                                                                                           PROTEIN --- Sc ---- 5e-127     NP_010542.1 catalase A; Cta1p [Saccharomyces cerevisiae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 1e-159     XP_001233111.1 PREDICTED: hypothetical protein, partial [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                               PREDICTED = Sp ==== 6e-172     XP_786217.2 PREDICTED: similar to catalase [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                  PROTEIN -== Ce ==== 0          NP_001022473.1 Y54G11A.5 [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                               PROTEIN -== Dm ==== 0          NP_536731.1 CG6871-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Dr ==== 0          NP_570987.1 catalase [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Hs ==== 0          NP_001743.1 catalase [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Mm ==== 0          NP_033934.1 catalase 1 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === ?? ==== 0          NP_001080544.1 catalase [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Xl ==== 0          ABK62836.1 catalase [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = Xt ==== 0          AAI23049.1 Hypothetical LOC548403 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK1024.3                                          TAA---------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------TGAATG---------------------------TAG------------TGA---------------------------------------------------------------------------------------------------------------------TGA------TAG---------------------TAA------TAA------TGA------------------------------TGA---------------------------------TAA---ATG---TAA------------------------------------------------------TAG---------------------TGA------------------------------ATG---------------------------------------------------------------------------TAA---------------TGA------------------------------TAA---------------------------------------ATG
                                                                   ORF                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  0   1   1           Hrt1 FL                          CAAQ4155.FL-MGC                                               GGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAA
  0   1   1           AbdN FLt5                   IMAGE:7005160.FL-MGC                                                        GGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       bld BrSp 5x3  out                    EC2BBA32CF02.g1 GGATTCTAGAGGCGAGGGTGACAGTTCTGAGTCCAGAGCGCTAACGGGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGATAAGGAACCCACAGACTCAT
  5   1   2       bld BrSp 5g3  in                     EC2BBA32DF01.g1 GGGGTTTTTATAATACGGTGACAGTTCTGAGTCCAGAGCGCTAACGGGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCC
  5   1   2   12  bld Tad5 5g3  in                         XZT25136.5p ...............CGGTGACAGTTCTGAGTCCAGAGCGCTAACGGGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCCAAG
  5   1   2   14  bld Te4  5g3  in                         CAAN7852.5p ...................TCGGTCGGATTCCGGGATTCGTCGACCCCGCGTCCGGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTTCAGTCATGACTTTCCCAGCAGCAG
  5   1   2       bld In54                            IMAGE:8944207.5p                              ACCCACCTGATGACTAGAGGAGCTACCGCTTCGAATTCGTCCCATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAACGCATCCCGGAACCTCACAGTGGAGAGCAAATCGCTTGTCTGCAGCGACCCTGACTACGGATAAATGACTTGTATGATCCATGCTGCTGTACTACCCATCGTGTCTTTCTACATCAGTCATGACTTCAGCAGCAGAGAATTCAGGTTCAATCCCGTT
  5   1   2       bld 1030 5g                         IMAGE:7027158.5p                                     AGCGCTAACGGGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACG
  5   1   2   10  bld Te1  5g3  in                         CBWN2692.b1 ............................................CGGGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGT
  3  -1   2       chi Abd0      in                       IMAGE:6998993                                              GGGACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGGCACAACACCCCAGTCTTCTTCATCCGAAATGCCATGTTTGTTCCATCCTTTATCCACTCTCCGAAAAAGAACCCACAGACTCATTTTAAAGAACCCGAATTGGGGGGGGATTTCTGGGTCTGCCCCCCAGTTTCTTCCCCAGGTTCCTTCTTGTTTTCGACCTGGTATCCGGAAGGCCCCCCCCCTAAATGGGTCGGTCCCCCCTTTAAATGGTCAAGCCAAAATAAATCTTTTTTTAATTCTTTTAAAAAGGACCGGGTCCGAACTCCCGGGGAAAAAAATTTTTTTTTCCCCCCCTAAGGGAAATATTTTAAATTTTTGGTTT
  5   1   2   20  bld Tail 5g   out                       CBSW11850.b1 .............................................TCCGCAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAACGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTC
  5   1   2       bld Hrt1 FL   in                         CAAQ4155.5p                                                GACAACATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTNCAGTCATGA
  5   1   2       bld In60 5g                         IMAGE:8947514.5p                                                      ATGGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACAGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAGACTGACCAAGCATCCGGAACCTCACAGTGGAGAAGCAAATCGCTTGTCTGCAGCGACCCTGACTACGGGATAACATGACTGTATGATCATGCTGCTGTACTACCATCGTGTCTTCTACTCCAGTCATGACCTTTCAGCAGCTGAGATCCAGTCCAATCCTTTGAATACTAAGTTGCCATGCATATGTCATACCGTTGGCTATAAGAGT
  5   1   2       bld In60                            IMAGE:8951123.5p                                                      GTCTTGATAATGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAACTGGTCAATGCCAAGATGAAGCTGTATATTGTAAATTCCATTACAGACTGACCAAGGCATCCGGGACCTCACAGTGAGGAGCAAATCGCTTGTCTGCAGCGACCCTGACTACGGGAATACATGACTTGATGATCATGCCTGCCTGTACCTAACCCAATCGTGTCTTTTCTACATCAAGTCAATGACTTTTCAGGCAAGCAGAAGAAAGTTCAG
  5   1   2       chi AbdN FLt5                          IMAGE:7005160                                                        GGCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGGAACCTCACAGTGGGAAGAAACCAAATTCGCTTTGTCCTGCCAGCCGACCCCTGTGACTACGGGGGAATACACTGGACCTTGGTAATGAAATCCCAATTGTCCTGGCCTTGGGTTAAACTTACCCCCATTTCGGTGGGGTTTCTTTNTTCCCTAACCAATTTTCTAAAAGGTTTT
  5   1   2       bld TpA       in                   TTpA018h15.p1kSP6                                                        GGGGCAAGACCGATAATGCGCGCCGACCTGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGACACCGGATGTCCTTACCACCGGTGGGGGCAACGCTATATCTGATAAGCTGAATCTCTTGACCGTTGGACCTCGGGGTCCCCTATTGCCTGCCCGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACACGGAGAGGATCCCAGACAGAGTTGTCCATGCTAAAGGAGCAAGAGCTTTTGGCTATCTTGAGATCACGCACGACATCACCTAATACAACAAGGCCCAAGTGTTTGATCACATTGCGAAGACAACGCCCAATCGTCATACTGTTCTCCACTGCCGCTGGGGAGTCCGGCTCTGCTGACACATGCCGAGACCCTCGAGGGTTTGCGGTTATAATGTCTACCCAGGATGGGAACTGGGACCTGACTGGCTACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTCCTTTCAATGTCTTATCACTCTCAGAATGGAACCCACAGACTCATTTAAAGGATCCGGATGTGGCGTGTGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATG
  5   1   2       bld In60                            IMAGE:8951740.5p                                                        TCCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGGCCCCTGTTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGCATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCCAAGATGAAGCTGTATATTGTAAATTCCATTACAGACTGACCAAGGCATCCGGAACCTCACAGTGAGGAGCAATCGCTTGTCTGCAGCGACCTGACTATGGATACATGACTGATGATCATTGCCGCTGGTAACTACCCATCATGATCTTTCTCTACAT
  5   1   2       bld Egg       in                   TEgg071i17.p1kSP6                                                         GCGGACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCC
  5   1   2       bld AbdN                               IMAGE:7006431                                                            GACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAATCTCACAGTGGAAGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTTCAGGCAGCAGAAGAAATTCAAGTT
  5   1   2       bld In63                            IMAGE:8960938.5p                                                            AACAAGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGATACATGACTTGATGAATCATTGCTGCTGTACTACCCATCGTGGTCTTTCTACATCAGTCATGACTTTCAGCAGCAGAGATCCAGGTTCATCCCTTTGATTACCAAATCTGGCCCATGGCCGATACCGCTCTAACTGGTATTGGCGTGACGACCTACTAACATCCTTTGTGCAAAAGATTTGAT
  5   1   2       bld Tad5      in                          XZT4085.5p                                                                AGAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGA
  5   1   2       bld Spl2      in                        CBSS8818.fwd                                                                 GAGGGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCA
  5   1   2       chi AbdN                               IMAGE:7004334                                                                    GGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCCTCGAGGGGTTTGCGGTTAAAATGTTTACAAAAGAAGGGGAAATGGGGACCCTTTTTTGGAAACAACCCCCCCAGTTCTTTCTTCTTCAGAAGAAAGCGCGGGGTGTTTCCTCCCCTCTTTTCCCCCCTCCCCCTAAAAAAAGGGACCCCCCACCTCCTTTTTTTTTATAAACCCCCCCCCCAAAAAATGGTGGGGGGAGAGATTTTTTGGGGGGGTTTGCGGCCCCCCCCCACAAATATCTTTTTATCCCTACAGGGTTTTCCCCTCCCTCCTTCGTTTTTCTTTAACCCAAGCGCGGGGAGATTTTCCTCGGACGAGAGGGGGCCCGCCCCCCCCCCCCCCCAAAATGGGAGGGGTGGGGGAATTGGTCCTCTCCCCCCCCCTCCTCTTAAACAAGAAGGGTGGGGGGGGGGCGGGGCCACAAAAAAAAAAAGAAACCCCGCCCTGTGTTGTGAGAAAAACACTTCCCCCCN
  5   1   2       bld Abd0                               IMAGE:7017157                                                                    GGATAATGCGGCCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATC
  5   1   2       bld In66                            IMAGE:8966181.5p                                                                               CCGACCAGATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGAGGAAGCAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGATCCATTGCTGCTGTACTACCATCGTGTCTTTCTAAATTCAGGTCATGACTTTCAGCAGCAGAGAATTCAGTTCATTCCTGGATTACGAATTGTCCAATGCGATACCGCTCATCCTTGGTGGTTAGTTGGGGGCTGGAACGAGAAAAGCTCA
  5   1   2       bld In66                            IMAGE:8965547.5p                                                                                    AGAATGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAGCTGTATATTGTAAATTCCATTACAGACTGACCAATGCATCCGGAACCTCACAGTGAGGAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGTAACTACCCATCGTGTCTTTCTACATTCAGTCATGACTTTCAGCCAGCCGAGAATCAGTTCATTCCTTGATTTACCAAATCTGCAATTGGCCGATACCCGCTCTACCTTGTAGTTGGGCTGACCGATCCACATATCGTGCATGACCTGTCATGATCCAGGAATCGTGTTCCTG
  5   1   2       bld Spl1      in                         CABK5709.5p                                                                                      TCAATTCGGCCGAGGGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCCAGCAGCAGAGAAAATTCAGT
  5   1   2       bld Hrt1      in                         CAAQ6082.5p                                                                                        TGAAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTTCCAGCAGC
  5   1   2       bld Lun1                                 CABD6143.5p                                                                                          AAGCTGTGGAAGGAGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTACCAAAATCTGGCCACATGGCGAT
  5   1   2       bld Lun1      in                         CABD1323.5p                                                                                                  GAAGGAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACAAAATCTGGCCACATGGCGATTACCCGCTCAT
  5   1   2       bld Lun1      in                         CABD2867.5p                                                                                                     CCGAGGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTNCAGTCATGACTTTCCAGCAAGCAG
  5   1   2       bld Liv1      in                         CAAR8062.5p                                                                                                      GAGAGCCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCG
  5   1   2       bld Ovi1      in                        CABI10867.5p                                                                                                      CCGAGGCGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAG
  5   1   2       bld Fat1      in                         CABC8110.5p                                                                                                       AGAGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAAATTCAGTTTCATCCCTTTGATTTACCAAAATCTGGCCACATGGCGAT
  5   1   2       bld Lun1      in                         CABD1885.5p                                                                                                        GACGAGGGGCTCTCAGAAACCAGATGTCCTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGC
  5   1   2       bld Lun1      in                         CABD4434.5p                                                                                                         AGCCGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCCAGCAGCA
  3  -1   2       bld Lun1      in                         CABD1891.3p                                                                                                            CGGGGCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCCAGCAGCAGAGAAATTCCAGTTTCATCCCTTT
  5   1   2       bld Lun1      in                         CABD1483.5p                                                                                                               GCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCATCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATC
  5   1   2       bld Lun1      in                        CABD10057.5p                                                                                                                GCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGA
  5   1   2       bld Lun1      in                         CABD1291.5p                                                                                                                GCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAG
  5   1   2       bld Lun1                                 CABD1572.5p                                                                                                                GGGCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTTCAGTCATGACTTTCCCAGCAGCAGAGAAATTCNAGTTTCATCCCTTTGATT
  5   1   2       bld Lun1      in                         CABD7796.5p                                                                                                                GCTCTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGNCAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGC
  5   1   2       bld Lun1      in                         CABD1530.5p                                                                                                                   CTCAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAAT
  5   1   2       bld Lun1      in                         CABD1922.5p                                                                                                                     CAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCATCCCTTTGATTTTACCAAATCTGG
  5   1   2       bld Lun1      in                          CABD506.5p                                                                                                                     CAGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCCAGCAGCAGAGAAATTCAAGTTCATCCCTTTG
  5   1   2       bld Lun1                                 CABD5823.5p                                                                                                                      AGAAACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTTCAT
  5   1   2       bld In54                            IMAGE:8945009.5p                                                                                                                       TGTTTTATTAACAGGGATCTCATCGATAACGTATTCGTCCCCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAGCAGAGAATTCAGTTCAATCCCTTTGATTTAACCAAATCTGTCACATGCGATTACCCGCTCATACTGTGGGTAGGTTGTGCTGAACAGAACCACTACTACTTTGCGAATGACACTGCTTGATCCAAGTTACATGCCCCTGCCATTGAAGCCCCAG
  5   1   2       bld Lun1      in                         CABD6931.5p                                                                                                                          ACCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCNCAGCAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTA
  5   1   2       bld Lun1                                 CABD5898.5p                                                                                                                           CCGGATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTA
  5   1   2       bld Fat1      in                         CABC4427.5p                                                                                                                               ATGTCCTTACCACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTNCAGTCATGACTTTCCCAGCAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCG
  5   1   2       bld Lun1      in                         CABD4773.5p                                                                                                                                    CTTACCACCGGCGGGGGAAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCT
  5   1   2       bld Int1      in                         CAAP8906.5p                                                                                                                                         CACCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAG
  3  -1   2       bld Int1      in                         CAAP1301.3p                                                                                                                                           CCGGTGGGGGCAACCCTATATCTGATAAGCTGAATCTCTTGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCCACTAACTACTTTGC
  5   1   2       bld In60                            IMAGE:8948779.5p                                                                                                                                                   TTGATTTATTAAATGAGGTACATCCGATTCTGAATTCGTCCCCCTCGGGGGCCCCTGTTGGTGCAGGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGCATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTATGGGATACATGACCTGTATGAATCCATTGCCGCTGGTAACTACCCATCATGGTCTTTCTACTTTCAGTCATGACTTTCCAGCAAGCAGAGATTTCAAGTCATCCCTTTGATTTACCAAATCTGGCCACATGGCGATAACCGCCTCATACCTGTGGTAAGTTCGGTGCTGACGATCCAACAACCTACTTTGCCGAGTGACAGCTGCTTTGATCCAGTACATGCCCCTGCATTGGACCAGTCGACAGAGTTGCCAGGCACTTCTCTATCCCGAACCTACCAGGGTAC
  5   1   2       bld Liv1      in                        CAAR11570.5p                                                                                                                                                                                  TGACCGTTGGCCCTCGGGGTCCCCTATTGGTGCAAGATGTGGTGTTCACTGACGAAATGGCCCATTTTGACAGGGAGAGGATCCCAGAAAGAGTTGTCCATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAAACCAACTAACTACTTTGC
  5   1   2       bld In54                            IMAGE:8943421.5p                                                                                                                                                                                                                                                                                    CATGCTAAAGGAGCAGGAGCTTTTGGCTATTTTGAGATCACGCACGACATCACCAAATACAGCAAGGCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAAATCAAGTTCATCCCTTTGATTTAACCAAATCTGGGCCACATGGCGATTACCCGCTCATACCTGTTGGTAGGTTGTGCTGAACAGAAACCAAACTACTACTTTGCTGAGTGGAGCAGCTGCTTTTTGATCAGTAACATGCCCTTGCATGAGCAGCCAGACAGAATGCTGCAGGGGCGACTATTTCCTCTAACTCGAAACACTACACAGGCATGT
  5   1   2       bld In60                            IMAGE:8950213.5p                                                                                                                                                                                                                                                                                                                  TTTTATATTTCAACTATCTCACATGCTTCGAATTCGTCCCAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGCATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTATGGGATACATGACCTGTATGAATCCATTGCCGCTGGTAACTACCCATCATGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGACAGAACCCAACAAACTACTTTGCAGAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAGCCCAGACAGATGCTGCAGGGCGACTTTCTCTACCCGACACTCACAGGCATCGCTGAGCAATTATCTGCAGCTGCTGTAACTGCCCTTACGACTCGGTGCCAATACCAGCGGATGACCATGTGCTTCATGCATTCAGGCCGGAACTCGAAATTATACCCTAGACG
  5   1   2       bld Brn4      in                        CAAL19012.5p                                                                                                                                                                                                                                                                                                                                                      GCCAAAGTGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCCAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCNCGACACTCACAGGCATCGCT
  5   1   2       bld Ovi1      in                         CABI8882.5p                                                                                                                                                                                                                                                                                                                                                      ATCGATTCGTTTGAGCACATTGGGAAGAGAACGCCAATCGCCATACGGTTCTCCACTGTCGCTGGGGAGTCCGGCTCTGCTGACACAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAAACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCA
  3  -1   2       bld Fat1      in                         CABC6128.3p                                                                                                                                                                                                                                                                                                                                                                                                                              CGGCTCTGCTGACCAGTCCGAGACCCTCGAGGGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCG
  3  -1   2       bld Int1      in                        CAAP11573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGGAGCTCCAAATTATA
  3  -1   2       bld Int1      in                        CAAP13921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGGCGGAGCTCCAAATTATTACCCC
  3  -1   2       bld Lun1      in                         CABD5591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTTGCGGTTAAAATGTATACAGAGGATGGGAACTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAG
  5   1   2       bld In60                            IMAGE:8947974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAAGAAAAAATGAGTAACTCAAAGTTTTAATATTCGTCCCCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCACTGCCTGTAAACTGCCCTTACAAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGCGGAGCTCCAATTATTACCCCACAGCTTCGTGCCCTGAGACCAGCCCAGTGAGGGAACCAGATCCACTGTCTGCGATGTTGCTCGCTAAATAGCCCCATGAGGAATGTTCCAGGTGCAACTTTATGGAATGCTATAGGACACGACTTGCCCTGGTGAAATGCCGACCTGAGATGCTCACTTTCATCGAAAGACTGGAATCCTGACTTACTGATTGGGCCGATCGCCTGTGGCACTACCTAGGTCGAATAGTGATACTACGCCTATCTCTC
  5   1   2       bld In60                            IMAGE:8948449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGGACCTGACTGGCAACAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACATCAGCGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCTGAGACAGCTCAGTGAGGAGCACAGATCACGTGTCTGCCGATGTGCTCGCCTACATAGCCGATGAGACAATGTCCAAGGTGCGAGACCTTACCGTGAAACGGCTAATTTA
  5   1   2       bld Thy1      in                        CBST1474.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACACCCCAGTCTTCTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCANGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAG
  3  -1   2       bld Liv1      in                         CAAR8753.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCATCCGAGATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCNCACAGCTTCTGTGCCCCTGAGAACCAGCCTNCAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTANCATAGCGCCGATGAGGACAATG
  3  -1   2       bld Lun1      in                         CABD5850.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGTCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCCAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACAACCCATCG
  5   1   2       bld Liv1      in                         CAAR3130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGCCATGTTGTTTCCATCTTTTATCCACTCTCAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAG
  3  -1   2       bld Int1      in                        CAAP13974.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAAAAGGAACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTG
  5   1   2       bld In66                            IMAGE:8965306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCCACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCACGTGTCTGCAGATGTTGCTCGCTACATAGCGCGATGAGACATGTTTCACAGTGCGAGACTTTTACGTGAAGTGCTAAGTGGAGGGAGCAGCGACTGGCGCCTGA
  5   1   2       bld In62                            IMAGE:8954633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGAACTCCATTTAAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGCATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTATGGGATACATGACCTGTATGAATCCATTGCCGCTGGTAACTACCCATCATGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACAAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGAGCACAGATTCCACGTGTCTGCAGATGTGCTCGCTACATAGCGTCGATGAGACATGTTTCACAGGTGCGAGAACTTTACGTGAAAGTGCCTAACTGAGGAACACCGAACTGGCCCTGTCTA
  5   1   2       bld In60                            IMAGE:8948817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACAGACTCATTTAAAGGACCCGGATATGGTGTGGGATTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTGCTCGCTACATAGCGCCGATGAGACATGTTTCACAGTGCAGACTTTTACGTGAAAGTGCTAGTGAGGAGCAGCGACTGCCCTGGTGTGAGAACATTGCAGGACCCTGAAGATGCTCAGCTTTCATCAAAAAGAGGCTGGTGCAATTTTCATA
  3  -1   0       chi Liv1      out                        CAAR5964.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCGCAGGCTGAGATCTGCCTGTGTGGCATTAGCCttagtatgttatagtatggcctattcttagcaacttttcaattggtcttcATTTTTTGTTATAGTTTTTTTTTAATTATTTGCTTTTCTCTTCTTACTGTAGCTTTCAAATTAATCAATTAAAAAGGAAATCTATTGCTGTGTGAAGCTACAAtgtaattgttactttttattcctgatcttgctatttaggccctcctctattcaaattcagtcctgtctctctttcaaaccactgcctggttgctaggttaaattggaccctagcaaccagatagcttctggaatgccaaactgCAGAAAAAAAAGCTAAATAAGTCAAAAACTGCAAACAATAAAAAATGAAGACCAAGTGAAGATTGTCCCAAAATAGCTCACAGGTATAAAAGGTTGGGGATCTATATCATACTAAAAGATAATTGAATCAACCTAACTGCTTCTCCCAAGAACCAAAAAAAACAGTTCTGTACCCCATGACTACAATGTAGCAACTGGATGTCCAGTTGGATGGCTTTCCCCATGTAGTGATGGTTGGACAATTCTGTTGTCAAAGACAAAACTGCATAGACCTCCTTGGGTATTGGCGTTGGTCTGTATCTCGTGTAGGGGCTAAATCTTTCCATAATGTCCTCCTAGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTAACTCACCTTATGGGTTCAGTTCTTGATAGCCT
  5   1   2       bld Mus1      in                         CABH7301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCGTTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTC
  5   1   2       bld In54                            IMAGE:8945606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCTGGGCTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACATAGCGCCGATGAGACAATGTTTCACAGTGCGAGACTTTTACGTGAAAGTGCTAATGAGAGCACGACTGCGCCTGGTGTGGAGAACATTGCAGACACTGGAGATGCTCAGCTTTTCATCAGAAGAGCTGTGAAATCACTGACGTCACTGAATCGTCCGATCAGCCTGTGACAGTACACCGCCGTGTAAGGGGC
  5   1   2       bld Liv1      in                         CAAR9349.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTGCGCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATT
  5   1   2       bld In62                            IMAGE:8955135.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCCCGAGTCTCTTCACCAGGTTTCCTTCTTGTTTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTGCAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACATAGCGCGATGAGGACAATGTTTCACAGTGCGAGACTTTACGTGAAAGTGCTAGTGAGAGCAGCGACTGCGCTGTGTGGGACATGCAGAACCTGAGATGCTCAGCTTTCATCAAAAAGCTGGAAATTCCTGACGTCACCTGATTGGGCGATCAGCTTGTGAAAGTCAGTGAGGGCAAAAACTGGGACTACTGATCCTAGCTCGAGGCAGCACTGACTTCGCGATCTCGAACTTATTCTAGCTAAAAGGAGTGCATAGGAATTGTCGGATCGATCACTTAGGACGCTGCTTTGACATACC
  5   1   2       bld In63                            IMAGE:8958427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCCTTTTAGTTAAACACAGCTCAAATAAAATACAAAATTCGTCCCCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACATGTTTCACAGTGCGAGACTTTTACGTGAAAGTGCTAGTGAGGAGCAGCGACTGCGCCTGTGTGAGACATTGCAGACACTGAGATGCTCAGCTTTTCATCAGAGAGAGCTGTGAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCGATTCAGGCTTCTGTATGG
  5   1   2       bld In54                            IMAGE:8943804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTATTGAGGATCCAATAAAATTCGAATTCGTCCCTGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGACACCTGAGATGCTCAGCTTTTCATCAGAGAGAGCTGTGAAAATTTCACTGACGTCACCTGAGTATGTGCCCGATCAGCCTCTGTTGACAGTACACGCTGAGGGCAAGAAGAAACTGTGACTAACTCAGCATCATTAAGCCACGCAGACAAGGCCAACTGTGCCTTCGGCT
  5   1   2       bld Fat1      in                         CABC6862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCTGACCGTGGTATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAG
  5   1   2       bld In60                            IMAGE:8951947.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATCCGTCGGCATTCCGGATGGTCACCGCCACATGAATGGCTACGGATCCCACACCTTCAAACTGGTCAATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTATGGGATACATGACCTGTATGAATCCATTGCCGCTGGTAACTACCCATCATGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACAAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAAACATGCAGACACTGAGATGCTCAGCTTTCATCAGAGAGAGCTGTGAAAATTTCACTGACGTCACCCTGAGTATGGTGCCCGGATTCAGGCTTCTGTTTGGAC
  3  -1   2       bld Ovi1      in                         CABI9023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCGGATCCCACCCTTCAACTGGGTCATGCCAAAGATGAAGCTGTATATTGTAAATTCCATTACAAGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAG
  5   1   2       bld In60                            IMAGE:8948463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTAAGGATGTGAACAACGCGAGGAGGAGTCAACTAATTCGTCCCGACTGACCAAGGCATCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAAGTGCTAAGTGAAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGACGATGCTCAGCTTTCATTCTGAGAGAGCTGTGAAAATTTCACTGACGTTCCCCCTGAGTATGGTGCCCGGATTCAGCTCTGTGGACAGTACAACGCTGAGGGGCAAGAAAGAACTGTGTAAACTACACCCAGCATTCCACTTACGCCCACTGCAAGGAACAAGGCCAACCTGTAAGCTTCCCGCTTTCAGATCATCGTTCCGGGAGCCATTTATCGTCAGGACGTTACAACTGACGATGAAATGCAGCAAGTCGGAGAGCAC
  5   1   2       bld In60                            IMAGE:8950240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAAATATATTAACGGAAAAGTTTCCCATTCTTTATTCGTCCCGGAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTATGGGATACATGACCTGTATGAATCCATTGCCGCTGGTAACTACCCATCATGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACAAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCTCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTTCTGCACATGTTGCTCGCTACAATAGCGCCGATGAGGATAATGTTTCCATGTGCGAGACTTTTACGTGAAAGTGCTAAAGTGAGGAGCAACGACTGCGCCCTGTGTGATAATATTGCAGGGACACCTGAAAGGATTGCTCAG
  5   1   2       bld In66                            IMAGE:8964522.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACCTCACAGTGGAGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTATGGGATACATGACCTGTATGAATCCATTGCCGCTGGTAACTACCCATCATGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACAAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGACATTGCAGACACCTGAAGGATGCTCAGCTTTTCATTCAGAGAGAGCTGTGAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAGTACACGCTGAGGGGGCAAGAAGAAAACTGTGAAATCTACTCCAGCATTCACTTACGCCACCGCAAAGGACAAGCTACTGTAGCTCTGCTTCAGATCATTCGTCGAGCATTTATTCGTCCATGACGTAACAAGAACTGATGATGTACTGGCGATCCGTAGGCGATCTTTAGTGTCCCTCTCCGCGCGCTGGA
  5   1   2       bld Hrt1      in                         CAAQ2162.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGAAGCAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGATTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTG
  5   1   2       bld Fat1      in                         CABC8283.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAATCGCTTGTCTGCCAGCGACCCTGACTACGGGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAA
  5   1   2       bld HdA       in                   THdA020h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATACATGACTTGTATGAATCCATTGCTGCTGGTAACTACCCATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTATCCGTCACATGACGT
  5   1   2       bld In54                            IMAGE:8944933.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATAGGTTTATGCGGGGGGGGCTGCGATTCATATTCGTCCCCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCACGCTCTGTTGGACAAGTACACGCTGAGGGGGCAAGAAGAAAACTGTGAAAACCTACACCCAGCATCCACTTACGCCACCGCAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAGATCATCCGTCCGGGAGCCATTTATCGTCCTGACGTTAACCAAGGAATGATGATGTACTGCGATCGGTAGCGATCTAATGTCCCTCCGCTGATCCTCGTGGCAATTACACTCAAAACTCCTCCTCATGGCTGACGGCTGGCCTTTGCGCCTAGTCCTAAAACGGCCATCTGAAAAAACTGACGATGCTAGACGATCTGACGTATCATGAGTACAGTGTTTATGGCGAGCTACCTGGTTAGCGTGCTCAGCG
  5   1   2       bld In54                            IMAGE:8944910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTTTTTTTAACAACCTTTAAAAATCATATTCGTCCCCAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCACATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGGACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGATGGTGCCCGGATTCAGCTCTGTTGGACAAGTACAACGCTTGAGGGGCAAAGAGAAAACTGTGAAACCTACACCCAGCAGTCCACTACGCGACGCAAAGACAAAGCAACCTGTAGCATTCTGCTCAGAATCATCGTCCGGAGCCATTTATTCGCACTGACGTAACCTAGACTAAGATGTCTGCATA
  5   1   2       bld In60                            IMAGE:8949679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGAATATTTGAAGGGAAGAGAAACTTCTTCATTATTCGTCCCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAGAAAACTGTGAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAGCCATCTGTTAGCTTCTTGCTTCAGATCATCCGTCCGGAGCCATTTTATTCGTCACATGACGTAACCAAGACTGATGATTGTACTGCGATCGTAGCGATCTTATGTCCTTCCCGCTGATCCTCTTGCGATTCAACTCAATCCCTCCTCCCATGCTGCACCGCTCTGCCTTTGGACGTCTCTAATGTCTCTTGTAGA
  3   1   2       bld Hrt1      in                         CAAQ6082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCGTGGTCTTTCTACATTCAAGTCATGACTTTCCAGCAGCCAGAGAAATTCAAGTTCAATCCCTTTGATTTACCAAAATCTGCCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCNCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACTTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAA
  5   1   2       bld Mus1      in                         CABH2773.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGTCATGACTTTCCAGCAAGCAGAGAAATTCAAGTTCAATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCANAGGACAAAGCCAACCTGTAGCCTTCCTGCTTNCAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTG
  5   1   2       bld Fat1      in                         CABC8335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAATTCAAGTTCATCCCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCANAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGNATCCCTC
  5   1   2       bld Liv1      in                         CAAR2262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAATCCNCTTTGATTTAACCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGNATCCCTC
  5   1   2       bld Liv1      in                         CAAR4568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGAGGCAAAATCTGGCCACATGGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACTAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGAC
  5   1   2       bld In54                            IMAGE:8946209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCGATTACCCGCTCATACCTGTGGGTAAGTTGGTGCTGAACAGAAACCCAACAAACTACTTTGCAGAAGTGGAGCAGCTGGCTTTTGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCACGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTTCCTGCTTCAAGATCATCCGTCCGGAGCCATTTTAATTCGTCACATGACGTTAAAAAAGACATGAATGATTGTACTGCGATTCGTAGCGATTCTAATGTCCCTCCCGCTGATTCATCGTGGCGAATCCACTCAATAACCTCCTCTCTCATTTGGCGTGCACGCCTCTGTCCCTTTGTCAGCCTCTAAGT
  5   1   2       bld Tad5      in                         XZT31026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTGCAGAAGTGGAGCAGCTGGCTTTCGATCCAAGTAACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCANATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATT
  5   1   2       bld Mus1      in                         CABH5893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACATGCCCCCTGGCATTGAGCCAAGCCCAGACAAGATGCTGCAGGGGCGACTTTTCTCCTACCCCGACACTCACAGGCATCGCTTGGGGCCAAATTATCTGCAGCTGCCTGTAAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCANATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCCTTTGTAACTGGAATAATCACATTGAG
  5   1   2       bld Tad5      in                         XZT11214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAACTGCCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCT
  5   1   2       bld In60                            IMAGE:8950368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTTACAGAACTCGGGTGGCCAATTACCAGCGGGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACCAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCCTTTGTTAACTGGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATATGTGCTGAGGCTTTTTACCCCTTTTGGGTAAAATGCTGTTTAAAAAATGCCTTAAAACAGTCAGCCAATCACAAGCCACTGTTATATTAATACGGCTAGTGGCAACAGGTATAGTATAGGTGGCACCTTAAAAAATGGAAAGCCACTTG
  5   1   2       bld BrSp      in                     EC2BBA26CE06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATGGACCCATGTGCTTCACTGACAATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGAATTACCACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCA
  5   1   2       bld Te1       in                         CBWN7458.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCAGGGCGGAGCTCCAAATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCT
  5   1   2       chi Tad5      out                        XZT47111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTATTACCCCAACAGCTTCTGTGCCCCTGAGAACCAGCCTCAAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGGTAATGTTAATTGCGGTTTCCATTTGCCCAGGCAATGTGGATATTACAGTGCCACCATTTATGGTGCAATGTCTTTCAAACTAGGGTACCTGTTATGCAGGCTCAgactgggagtcaaaataggccctggcatttctggtacccagagacccaaacagcccccccagcccaataaacagtgactgtctatggcatcttaagcagcccatctgacatttgcctgaacccacagattgccagtccgggcctgCTGTCAAGTTTTTACTCAACTCCCCTCTTCTTTTGGCACCTATTTCCCACTATAGAGTATGGTATGACCATACATTTTGTGAGAAGTCCTGACAGCCATATAAACAGTAGATTAAGCCACAATATAACCTTTAACATGACCATTTTTCCCCAGTGACCCCAAGCACAGATTTATATTCCCATCTGCATAGTAGGGTTAGATC
  5   1   2       bld Spl1      in                         CABK1024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCGATTCGCTCAGTGAGGGAGCACAGATTCCACGTGTCTGCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGC
  5   1   2       bld Lun1      in                         CABD2475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGTGTCTGCAGATGTTGCTCGCTACATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCGCCGCANAGGACAAAGCCAACCTGTAGCCTTCCTGCTTNCAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACG
  5  -1   2       bld Int1      in                         CAAP1301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGATGTTGCTCGCTACAATAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACNTGAAGGATGCTCAGCTTNTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCA
  5   1   2       bld Lun1                                 CABD2667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGCGCCGATGAGGACAATGTTTCACAGGTGCGAGACTTTTACGTGAAAGTGCTGGGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCACGACACCTGACGGATGCTCAGCTTTTCATTCAGATGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGCATTCAGGCTCTGTTGGACAAGTACAACG
  3   1   2       bld Fat1      in                         CABC8283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGTGCGAGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACNTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAAGTGACCATGCATTAGTG
  5  -1   2       bld Hrt1      out                       CAAQ11685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACCTGAAAGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAAT
  3   1   2       bld Fat1      in                         CABC8335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGACCATTGCAGGACACCTGAAGGATGCTCAGCTTNTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTAT
  3   1   2       bld Mus1      in                         CABH5893.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACTTTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATGNCAGGACACNTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg071i17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTACGTGAAAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATGNCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCNAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      ?                          CAAP1993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 atgcaggggggcagttaatcacagtactgataccatttaaagcttacacaagagtaagccatcaaagcagccagacaggtggggggccacacagaggggggttgcgggctgccagttggacagcactgctttaagGAAATACATATAAATATTTTGAATGTATATTCTTTTCCCTTTTACAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAA
  3   1   2       bld Liv1      in                        CAAR11570.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATGCAGGGACACCTGAAGGATGCTCAGCTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTG
  5  -1   2       bld Int1      in                        CAAP13974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTAAGTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATGCAGGGACACCTGAAGGATGCTCAGCTTTCNATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAACCTG
  5  -1   2       bld Fat1      in                         CABC6128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGAGGAGCAGCGACTGCGCCTGTGTGAGAACATTGCAGGACACNTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATG
  5  -1   2       bld Lun1      in                         CABD5850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAGGAGCAGCGACTGCGCCTGTGTGAGAACATGCCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAA
  3   1   2       bld Mus1      in                         CABH2773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCGACTGCGCCTGTGTGAGACATTTGCAGGACACNTGAAGGATGCTCAGCTTNTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAA
  3   1   2       bld Liv1      in                         CAAR3130.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCCTGTGTGAGAACATGGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCAAAAAAA
  3   1   2       bld Lun1      in                         CABD1323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCCTGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCC
  3   1   2       bld Mus1      in                         CABH7301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCCTGTGTGAGAACATTGCAGGACACCTGAAAGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAA
  3   1   2       bld Int1      in                         CAAP8906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAA
  3   1   2       bld Ovi1      in                         CABI8882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCC
  3   1   2      seed Spl1      in                         CABK1024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGAGAACATGNCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Liv1      in                         CAAR4568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGAGAACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Spl1      in                         CABK5709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGAACATTGCAGGACACNTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATG
  5   1   2       bld Fat1      in                         CABC8219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACATTGCAGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCCTACATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGA
  3   1   2       bld Lun1      in                         CABD1291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGGACACCTGAAGGATGCTCAGCTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Lun1      in                        CABD10057.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGACACCTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Lun1      in                         CABD4773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACACCTGAAGGATGCTCAGCTTTCATTTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAA
  3   1   2       bld Fat1      in                         CABC4427.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACNTGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAA
  3   1   2       bld Te4  5g3  in                         CAAN7852.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAAAATACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Fat1      in                         CABC6862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Lun1      in                         CABD6931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCC
  3   1   2       bld Liv1      in                         CAAR9349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Lun1      in                         CABD1885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Ski1      out                       CABJ11995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Lun1      in                         CABD4434.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATG
  5  -1   2       bld Lun1      in                         CABD5591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGATGCTCAGCTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAGTACATTTTTCGTTAACAGGTTAATTGTAGGAAAAAGAATGAGAG
  5   1   2       bld Liv1      in                         CAAR7619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGCTCAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAG
  5  -1   2       bld Int1      in                        CAAP11573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATG
  3   1   2       bld Hrt1 FL   in                         CAAQ4155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAGCTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAA
  3   1   2       bld Fat1      in                         CABC8219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTTCATTCAGAAGAGAGCTGTGAAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAAGTGACATGCATTATGATCT
  3   1   2       bld Brn4      in                        CAAL19012.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATTCAGAAGAGAGCTGTGAAAAATTTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  5  -1   2       bld Ovi1      in                         CABI9023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAAGAGAGCTGTGAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAA
  3   1   2       bld Liv1      out                        CAAR9822.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACACAGAGGGGGGTGCGGGCTGCCAGTTGGACAGCACTGCTTAAGGGAAATACATATAAATATTTTGAATGTATATTCTTTTCCCTTTTACAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCAAAAAA
  3   1   2       bld Liv1      in                         CAAR8062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGAGCTGTGAAAATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAAGCCTCTCGCCCTA
  3   1   2       bld Lun1      in                         CABD8248.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACGAGGATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  5  -1   2       bld Abd0                               IMAGE:6999262                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGGAAAAATTTCACTGACGTTCACCCTGAGTATGTGCCCGGATTCAGGCTCTGTNGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTAACGAAAAATTACTT
  3   1   2       bld Lun1      in                         CABD1530.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCC
  5   1   2       bld Lun1      in                         CABD8248.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAAACGAAAATGTACTTTTGTTATTAAAATGACATGCATTATGATCTAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Int1      in                        CAAP13921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACG
  5  -1   2       bld Lun1      in                         CABD1891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAAGTGACATGCA
  3   1   2       bld Liv1      in                         CAAR2262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACACNGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAA
  3   1   2       bld Lun1      in                          CABD506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATC
  3   1   2       bld Thy1      in                        CBST1474.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGTTCACCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACCAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAAGTGACATGCATTATGATCT
  3   1   2       bld BrSp      in                     EC2BBA26CE06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTGAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGAATTACCACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAAAGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGATTTATCTACTAAGCAGAGAAGGGCTTGTATCACCTGACTCTCATCTTTTCCTA
  5  -1   2       bld Abd0      in                       IMAGE:6998993                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATACGCCTGAGTGTTTTTTTTTTGAGGGGGGAAAATTTCTCATTCCCCTTAGGGGCCGTTCTGGTTTTTAAAAAAAACGGGGGGGAAAAAAAAATTTGAAACTTCCCCGGTTTCCTTTACCCCCCAAAGGAAAGCCCACCTTGCCTTCTGTTTCAAAATCTCCTCCGGGACCTTTTTATTCGTCCCTGGGGTAAACAAAAGACCTGAAGGATTTATGGATTTGGTAGGAATCTTAGTTCCCTCCCGCGATTCCCTCGGGCGGATTTAAACTTAAATACTCTTCTTTCATTTGGTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACTAATTAAC
  3   1   2       bld Fat1      in                         CABC8110.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGTATGGTGCCCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Lun1      in                         CABD1483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCGTCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAATATGACATCGCATTATGATCT
  3   1   2       bld Lun1      in                         CABD1922.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTAG
  3   1   2       bld Tad5      in                          XZT4085.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTCAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAAAAAAAGGG
  3   1   2       bld Hrt1      in                         CAAQ2162.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATCCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Ovi1      in                        CABI10867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGCTCTGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCC
  3   1   2       bld Lun1      in                         CABD7796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  5  -1   2       bld Liv1      in                         CAAR8753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Lun1      in                         CABD2867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Spl2                                CBSS3654.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Te1  5g3  in                         CBWN2692.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGGACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACCACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTGATATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGATTTATCTACTAAGCAGAGGAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT11214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAAGTTCACCGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACNCCCAGCATCCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTAGATCTAAAATAAAAAAAAAAGGG
  3   1   2       bld Tad5      in                         XZT31026.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGGCGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTTTGCCCTTTTGCAGCTTTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATTTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCCTTTTGG
  5   1   2       bld Bone      in                       CBTC10986.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCA
  3   1   2       bld Tad5 5g3  in                         XZT25136.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGTACAACGCTGAGGGGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Liv1      in                         CAAR7619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCAAAGAAGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCC
  3   1   2       bld Bone      in                       CBTC10986.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAACTGTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACCATGCATTATGATCT
  3   1   2       bld Te1       in                         CBWN7458.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGAAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA32DF01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACCACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTACATCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTT
  3   1   2       bld Lun1      in                         CABD6459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTTATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAA
  5   1   2       bld Lun1      in                         CABD6459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAACCTACACCCAGCATTCCACTTACGCCACCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAA
  3   1   2       bld Lun1      in                         CABD2475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACACCCAGCATTCCACTTACGCCGCCGCAAAGGACAAAGCCAACCTGTAGCCTTCCTGCTTCAAGAATCATCCGTCCGGGAGCCATTTTAATCCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTACAAAAAA
  3   1   2       bld Spl2      in                        CBSS8818.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCCGTCCGGGAGCCATTTTAATTCGTCACATGACGTTAAACAAAAGACATGAATGATTGTACTGCGATTCGGTAGCGAATCTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  3   1   2       bld Sto1      in                         CABG9512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  5   1   2       bld Sto1      in                         CABG9512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAGTGTCCCTCCCGCTGATTCCCTCGTGGCAGATTTACAACTCAAATACTCCTCTCTCATTGGCTGCACGCTCTGCCCTTTTGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                         CABJ2460.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCT
  5   1   2       bld Ski1      in                         CABJ2460.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGCTCTAAGTTCTTTAGAAAACTGACAAAATTCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATGACATGCATTATGATCTAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA018h15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAAAGTGGCAAAAGTTTTAAAAAGGATACTCCCCTGATTTGAATGGGAACCCGGGAAATTCCTTTGTGAACTGGAATAATCACATGGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTGGGGGTTAAAA
  3   1   2       bld HdA       in                    THdA020h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATTTTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGAAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTGTGGGAGTTGTGGGATTTATCTACTAAGCAGAGAAAGGCTTGTGATCACCTGACTCTCATTCTTTTTCCTACAATTAACCTGTTAACGAAAAATGTACTTTTGTTATTAAAAATTGACCATGCACTTATGATCTANAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  5  -1   2       bld Mus1      in                        CABH11107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTTAAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGG
  3  -1   2       bld Mus1      in                        CABH11107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTTAAAAAAATACTGACCTGATTTGCATAGGAACACGGGAAATTCCTTTGTTAACTGGAATAATCACATTGAGTTAATACAAGTTATGTTTTATTATGTTGCTGAGGCTTTTACCCCTTTGGGGTTAAAAATGCTGTTTAAAAAATGCCTTAAAACAAGCCAGCCAATCACAAGCACTGTTATATTAATACGGCTAGTGGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGG
  5   1   2       chi AbdN                               IMAGE:7021196                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGAACAGTATAGTATAGGTTGCACTTAAAAAAATGTAAGCACTTGTGGCAGGCAGTTTGGGCACTAATGGGCTTCCAGAGCAGTGGGCCTGATTCGGTCACTGATCTATCCATCTGCCTGTNNGTGGGAGTTGNTGGGATTTATCTACTAAGCAGAGAAAGGCTTTGTGATCACCCTGAACTCTCATTCCTTTTCCTTACATTAACCTGTTAAACGAAAAAAGGAACCTTTGGTTTTTAAAAATGACCGGGCTTTTTGATTCTTCCTAAAAAAAANAAAAAAAAAAAAAAAAAAAAAGGGGGGCCCCTTATATACCCCCCAGGGAGGGGCCCCCCTTAGGGGGGGCCCTTTTTTAAAAAAACAAGGCCCTGGGGCCCCTTTTTTTTTAAAAACCCCCTGGGGGGGGGGGGAAAAAAAAACCCCCCCCCCCCGGGGGGGGGATTTTTTTTGTGGGGAAAAAAACACCCCCCCCTTCTTTCTGGGGGGGGGGGGGCCAAAATTTTTGGGGGGAAAAACCCCCCCCCCCCCCCCAAAAGAATATTTTTAAAACCCCCCCCCCCCGGGGGGAGAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTNCGGAGGAGAAAAAGAAGGGGGGTGGGGTAAAAAAAAAAAAAAAACCCCCCCCCCTTATATTTTTTTATTCTTTCGCCGCCGCCCTAAGAAAAAAAAAAATATTTTTCTTTCCCTCCCCTCCCGCCCGNGGGTTTTTTTTTTATTTTATTAAAAAAAAAAATATTTTTCCCCTCCGCGCGCCGCGCGCGGGGGGGGGGGGGCGGAAACAN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)