Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012070708 Xt7.1-CABD8198.3.5 - 149 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABD8198.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAAACAACAGACAGATCTAGAGAAGAAAAAATCCCCAGACTTACACAATTGCATAGTTGGCTGGGGGAGGGGGAAGTACACACTTGTGTCACCACAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTT
                                                  Xt7.1-CHK-1008222330                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAGACAGATCTAGAGAAGAAAAAATCCCCAGACTTACACAATTGCATAGTTGGCTGGGGGAGGGGGAAGTACACACTTGTGTCACCACxGxCxxTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTxxAxxxGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     4     3     6     3     6     3     6    11    15    17    20    22    25    25    30    32    38    37    43    43    47    48    52    50    54    51    54    51    54    53    56    53    56    53    57    53    57    53    58    53    58    53    58    54    59    54    59    55    60    55    60    55    61    54    61    55    61    55    61    55    61    55    61    56    62    56    62    59    62    61    63    61    63    60    62    60    62    63    65    62    64    62    64    62    64    60    64    60    64    59    63    59    63    59    63    59    63    59    64    59    65    60    65    62    66    62    66    61    65    61    65    61    65    62    66    62    66    62    66    62    67    62    67    61    67    59    66    65    74    68    79    70    87    75    90    79    93    84    96    85    97    85    97    85    97    90   101    88    99    89   100    87    98    88   100    94   103    88    97    92    99    82    94    84    91    82    87    81    86    80    85    80    84    80    84    80    84    82    84    79    84    78    84    77    84    77    85    76    83    77    83    77    82    77    83    77    83    77    84    77    84    77    86    77    86    76    86    74    83    73    83    74    83    73    83    73    83    75    84    76    84    76    84    75    83    74    82    74    82    74    82    74    82    73    81    73    81    73    81    71    80    70    80    69    78    69    78    69    77    68    76    65    75    63    74    64    74    64    72    61    71    60    70    57    69    32    45    29    38    25    37    15    25     7     9     7     7     7     7     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5
  5   1   2  SIG                                      Xt7.1-CABD8198.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABC4240.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGGTGAGACCTAGAGACGAGTTCATCATAGTAATGGCATGGGAATGAATGGCAGTTAAACCAGTTTCAAGCACATGTAATAATTAGCCTAATGTTAAAGAATTTTTAATAATCTGTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGACTAGTATTGCAGCTCACCGACATGCCGCTATGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTATGAATTATTATTTCCTATTGCTTGGCAGTTTCTAAATTTATGAAGTTTTATTCACCTCGATCTTTCCCACACACTGAACCTTAACACCACTTCACTTACTGGTTCCCAAAGGGGAGGGGGGGGTACATTTTCTACTTCTGAATGATGAAATAGTAAATACAGAAATGACATTTTGTAATAAGATGCTAAGATTGGAAAGCTAGTTTGTCATTTCCCATAAACCTGCTAGTTCATCTTTTCTTTTTTTATGGTTAAATGACACAAATTTGCTTCTCTATTTTAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTTCCCTTCTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                               BLH ATG     221    1237                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     221     121                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     221      43                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      90      18                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     221       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Bf ---- 2e-011     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 7e-011     NP_010550.1 Negative regulator of pheromone response pathway; required for endocytosis ofpheromone receptors; involved in cell shape control; Akr1p [Saccharomycescerevisiae] -----------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Ce ---- 7e-015     NP_493429.1 predicted CDS, mechanosensory transduction channel NOMPC (1O503) [Caenorhabditiselegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 8e-026     NP_999819.1 NFkB protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 2e-028     BAE06505.1 IkappaB [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 3e-029     NP_476942.1 CG5848-PB [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 1e-077     NP_955923.1 NF-kappaB inhibitor alpha-like protein B [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 3e-101     NP_065390.1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor,alpha; Nuclear factor of kappa light chain gene enhancer in B-cells [Homosapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Gg ---- 2e-102     NP_001001472.2 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 2e-102     NP_035037.1 nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, alpha;I(Kappa)B(alpha); nuclear factor of kappa light polyp gene enhancer in B-cell 1[Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 4e-163     AAH77876.1 MGC80640 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 4e-163     NP_001086998.1 MGC80640 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          CAJ83355.1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABD8198.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA------------------------------------------------------------------------------------------------------------------ATG------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------ATG---------ATG---------------ATG---TAAATG---------------------------TGA------------------------------------------------------TAA------------------------ATG------------------TAA------------------------TAA------------------------------------------TGA---ATG------------------------------------------------------ATG---TAA---------------------TAA------------------------------------TAA------------------------------TGA---TGA------------ATG------TGA---------------------------TGA---------TAA---TAG---------------------TAA---------------TAG------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2  SIG                                      Xt7.1-CABD8198.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAAAAAA
                                                  Xt7.1-CHK-1008274644                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAAAAAAAAAAAA
  5   1   1           Gas1 FL                     IMAGE:5309348.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu099d12.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAAAAAAAAAA
  5   1   1       add Neu                            TNeu082d21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCTCTGACTTGCTGCCTCAAGGGGTGGGGGCTGGCAGGCACCCAGGGCAGGACTCTGGCTTTGGAAAGTCCCTGGCCAGTAGCCAGGAACACAACTGCACACACACACACTCTCACACTCACAGCAGAAAGCGGAAAACAACAGACAGATCTAGAGAAGAAAAAATCCCCAGACTTACACAATTGCATAGTTGGGTGGGGGAGGGGGAAGTACACACTTGTGTCACCACTGACTAGTATTGCAGCTCACCGACATGCCGCTATGATGAAATAGGTGCATTATGAATTATTATTTCCTATTGCTTGGCAGTTTCTAAATTTATGAAGTTTTATTCACCTCGATCTTTCCCACACACTGAACCTTAACACCACTTCACTTACTGGTTCCCAAAGGGGAGGGGGGGGTGCATTTTCTACTTCTGAATGATGAAATAGTAAATACAGAAATGACATTTTGTAATAAGATGCTAAGATTGGAAAGCTAGTTTGTCATTTCCCATAAACCTGCTAGTTCATCTTTTCTTTTTTTATGGTTAAATGACACAAATTTGCTTCTCTATTTTAACATGTGCTTTTTATGTTCCCTTCTAGGTGTCTCCATTTGGCAATTATCCATGAAGAGAAAACCC
  5   1   2       add Fat1      in                         CABC1202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCCAGGGGCAGGACTCTGGCTTTGGAAAGTCCCTGGCCAGTAGCCAGGAACACAACTGCACACACACACACTCTCACACTCACAGCAGAAAGCGGAAAACAACAGACAGATCTAGAGAAGAAAAAATCCCCAGACTTACACAATTGCATAGTTGGCTGGGGGAGGGGGAAGTACACACTTGTGTCACCACTGACTAGTATTGCAGCTCACCGACATGCCGCTATGATGAAATAGGTTCATTATGAATTATTATTTCCTATTGCTTGGCAGTTTCTAAATTTATGAAGTTTTATTCACCTCGATCTTTCCCACACACTGAACCTTAACACCACTTCACTTACTGGTTCCCAAAGGGGAGGGGGGGGTACATTTTCTACTTCTGAATGATGAAATAGTAAATACAGAAATGACATTTTGTAATAAGATGCTAAGATTGGAAAGCTAGTTTGTCATTTCCCATAAACCTGCTAGTTCATCTTTTCTTTTTTTATGGTTAAATGACACAAATTTGCTTCTCTATTTTAACATGTCCTTTTTATGTTCCCTTCTAGGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGGTAATTTACTTTTTATTTTTTTTCTAAACCTTGTAAAAACTTTATTTCTAGATTAGCTTGTCATGTGCCACCATTGTCGGTTAGGGCAGGGCTGTCCAACTGGAGGCCCGTGNGCCGGATGTGGCCCTCCAAAGGAATTTTAACATATAAAGTATAATAGAGGGCCAGTTTGTGGAATAATTGACCTATGACATGTAAG
  5   1   2       add In54                            IMAGE:8946796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGTGGCTACTGCATCCCCCCTGACGTGCGACTCGAATTCGTCCCGAAAGCGGAAAACAACAGACAGATCTAGAGAAGAAAAAATCCCCAGACTTACACAATTGCATAGTTGGCTGGGGGAGGGGGAAGTACACACTTGTGTCACCACTGACTAGTATTGCAGCTCACCGACATGCCGCTATGATGAAATAGGTTCATTATGAATTATTATTTCCTATTGCTTGGCAGTTTCTAAATTTATGAAGTTTTATTCACCTCGATCTTTCCCACACACTGAACCTTAACACCACTTCACTTACTGGTTCCCAAAGGGGAGGGGGGGGTACATTTTCTACTTCTGAATGATGAAATAGTAAATACAGAAATGACATTTTGTAATAAGATGCTAAGATTGGAAAGCTAGTTTGTCATTTCCCATAAACCTGCTAGTTCATCTTTTCTTTTTTTATGGTTAAATGACACAAATTTGCTTCTCTATTTTAACATGTCCTTTTTATGTTCCCTTCTAGGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCATCTGTGACTATGATGGGTCCCACGTGCCTCCACTGGCATCGATCCATGGCCTATCTTTGCAATTGGTGGAAAATCCTTCATTAAAATAAGGGGGCTGG
  5   1   2       add In66 5g                         IMAGE:8964199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGATTATTAAAAAAATACTATTCCCCTTACTTTTTAAAAAACCCCAGAAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCCTATCTTGCAATTGTGGAAAATCTCATTAATAAAGGGGCTGATATAAATGCCCAGGAGGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAAACTACGAACCTGATGAAACTGCTGCTTAAGCACGGAGCCAGATGTAAACAGAAGTCCACCGTACCAAGCTTAACTCTCTCCGTGGTCCACGCCTTCTACAC
  5   1   2       add In54 5g                         IMAGE:8943057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCCCAGTGATCAGACGAGCCGTCGATACGAATTCGTCCAGAAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAATCTCATTAATAAGGGGCTGATATAATGCCCAGGAGCCTTGCATGGTCGCACTGTGCTGCATATGTCGTGACTGCAGACTACGACTGATGAACTGCTGCTAGCACGGAAGCAGAATGTTAACAGAAGTCACGGTAACCAAGC
  5   1   2       ext In54 5g                         IMAGE:8943190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACACACTGATCCAGACGATCAGTCGATACGAATTCGTCCCAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCAT
  5   1   2       ext Egg  5g3  in                   TEgg036b09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTACCAGAAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCAT
  5   1   3        nb Abd0 5g                            IMAGE:7018311                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACCAGAAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGN
  5   1   0       chi Thy1      in                       CBST13148.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGAAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAAGCTACAGCTACAGAACTTCACTATCGCAACTGAGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGATATAACATGC
  5   1   2       add AbdN 5g                            IMAGE:7025019                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAAATGTGGGAAAATCTCATTAAATAAGGGGGCTGATATAAATGCCCCAGNAAGCCTTTGCAATGGGTCGCACTGTTGCTGNCATATGGGCCGNTGGGACCTGCAGAACCTACGAA
  5   1   3   10   nb Spl2 5g3  in                        CBSS6910.fwd ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATC
  5   1   3        nb Gas1 FL   in                    IMAGE:5309348.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGA
  5   1   3        nb TbA  5g                        TTbA045c04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTCGCTCTGATCGGATGGGATTAGTATATAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGTCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGNGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCT
  5   1   2   10  ext Spl2 5g3  in                        CBSS2231.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAANGNGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTG
  5   1   3   10   nb Spl2 5g3  in                        CBSS8619.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCAT
  5   1   3        nb Egg  5g                        TEgg135p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTC
  5   1   3   10   nb Spl2 5g3  in                        CBSS9811.fwd .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCGCTCTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCC
  5   1   3        nb AbdN 5g                            IMAGE:7022742                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGGAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCC
  5   1   3   12   nb Gas7 5g3  in                         XZG60409.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGATTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTT
  5   1   3   10   nb Thy1 5g3  in                        CBST4490.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGA
  5   1   2       ext TpA  5g3  in                   TTpA069n09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCGGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAGGGCTACTCTCCGTGCCAGCTCACATGGGGC
  5   1   3   10   nb Thy1 5g3  in                        CBST4979.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGATGGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAA
  5   1   3        nb Neu  FL   in                   TNeu099d12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGC
  5   1   2   22  add Tad5 5g                              XZT66316.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGGTAATTTACTTTTTATTTTTTTTCTAAACCTTGTAAAAACTTTATTTCTAGATTAGCTTGTCATGTGCCACCATTGTCGGTTAGGGCAGGGCTGTCCAACTGGAGGCCCGTGGGCCGGATGTGGCCCTCCAAAGGAATTTTAACATATAAAGTATAATAGAGGGCCAGTTTGTGGAATAATTGACCTATGACATGTAAGTTGGCCAGCACTTAAAATATTAATAGTCAGTGCACTCATAGCATGTTCATGAGGGATAGAATATAGTACAAGCTTATTCTGCAAGTTCAATTTTGTGTTTAATGAGAATGAATTTACTGATTTTTCTTTTTTTTTTAATGTCTTTTCTGCAGACAGCACTACATCTGGCAGTAATCACCGAAACACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAAT
  5   1   3   10   nb Thy1 5g3  in                       CBST10058.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCAC
  5   1   3   10   nb Spl2 5g3  in                        CBSS6719.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTAGTATAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCT
  3  -1   3        nb Liv1      in                         CAAR5684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGAGAGGCGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGC
  5   1   3   10   nb Spl2 5g3  in                        CBSS8300.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGAC
  5   1   3        nb AbdN 5g                            IMAGE:7020863                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGGAGGCTACAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAANGGNGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGGTACAAAGGCTACTCTCCGTGCCCAGCTCACATGGGGGCAGAAATTAACATGCTTGATTCAACAACAAACTGGGTTGAAAGTGACCCACAAGAAATTTGCCAGTACC
  5   1   3   10   nb Spl2 5g3  in                       CBSS10608.fwd .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTACAGCTACAGAACTTCACTATCGCAACTGGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGAT
  5   1   3   10   nb Liv1 5g3  in                         CAAR3777.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTACAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTTCACAACAGCTGGNTGAAGTGA
  5   1   3        nb HdA  5g3  in                   THdA020f01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACAGCAACGTTCACTATCGCAACTGGGATTCTAGAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGGCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAGGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCATCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACGCGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACGGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAGCGACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCACAAATCCGAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGAACCTGATGAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCG
  3  -1   2       add Lun1      in                         CABD6299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTATAGGGCGAGGGCCGCAACTGGGATTCTACGGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCNACAACAGCTGG
  5   1   2   10  add Liv1 5g3  in                         CAAR5635.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGTCAGTATTCCCCCTACTTCACTTGGCTACATACTGATGTTTCTTCCTGCCATGTCTATTGGATTCAATTTTGCCTCTAGATCTAAGAGAAATTTCTGTTTCCCTCACCACAGGAGCCTTTGCATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCT
  5   1   3        nb Lun1      in                         CABD1989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGGCAGAAATAACATGCTG
  5   1   3        nb Ovi1      in                         CABI1238.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGNGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAGGGCTACTCT
  5   1   4   10 seed Ski1 5g3  in                         CABJ3201.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGNGGCAGAAATAACATGCTGATTCAACACAGCTGGNTGAAGTGA
  5   1   3   10   nb Ski1 5g3  in                         CABJ5894.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAACTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGAT
  5   1   3   10   nb Ski1 5g3  in                         CABJ3292.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTTCACACAGCTGGTTGAAGTGA
  5   1   3   10   nb Mus1 5g3  in                         CABH4393.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACTATCGCAACTGGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGC
  5   1   3        nb Lun1      in                        CABD10726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCANGGCTACTCTCCGTGCCAGCTCACAT
  5   1   2       ext Lun1      in                         CABD8198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACACAGCTGGTTGAAGTGACACAC
  5   1   3   10   nb Ski1 5g3  in                         CABJ4250.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACTATCGCAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAC
  5   1   3        nb Lun1      in                        CABD13589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCAACTGGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACNCAGGCTACTCTCCGTGCCAGCTCACAT
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ8897.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACTGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGC
  5   1   3   10   nb Ski1 5g3  in                         CABJ8728.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGGATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATG
  5   1   3   10   nb Int1 5g3  in                        CAAP12140.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTCTACAGTGTCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCANGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTC
  5   1   3        nb Ovi1      in                         CABI1798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATCGATTCGTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTA
  5   1   3   10   nb Fat1 5g3  in                         CABC1868.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGCTTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGNGCAGAAATAACATGCTGATTTCAACACAGCTGGTTGAAGTGA
  3  -1   2       add Fat1      in                        CABC11449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATATAGGGCGAGAGGCTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTATGTATCAAACTTAATCTATAAACCTTTAGACGTGTGTTGTTGTGCTACTTGGCAAATTAGAATTAGAACTGCCTTGCTAATATCTTTCTTTCCGATGCAGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCCTTGCATGGTCGCACTGTGCTGCATAT
  5   1   3   10   nb Int1 5g3  in                        CAAP12866.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTC
  5   1   3   10   nb Int1 5g3  in                         CAAP3363.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAAGCTATTTTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGG
  5   1   3   10   nb Thy1 5g3  in                        CBST9648.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTGCGGGGAAGCTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCCAGA
  3  -1   3        nb Int1      in                        CAAP14503.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGCGGGGAACTCAACAACCGGCCGCCGCCATGTCTGTGCCTTTTCACGATTACCAAGGGAGTATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTG
  5   1   3   10   nb Fat1 5g3  in                         CABC4977.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGNGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGA
  5   1   3        nb Int1      in                        CAAP13161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAG
  5   1   2       add Int1      in                        CAAP10708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAGGGGTTCCCAAAGGGGAGGGGGGGGTACATTTTCTACTTCTGAATGATGAAATAGTAAATACAGAAATGACATTTTGTAATAAGATGCTAAGATTGGAAAGCTAGTTTGTCATTTCCCATAAACCTGCTAGTTCATCTTTTCTTTTTTTATGGTTAAATGACACAAATTTGCTTCTCTATTTTAACATGTCCTTTTTATGTTCCCTTCTAGGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTT
  5   1   2       add Fat1      in                         CABC7437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTATTCTGCAAGTTCAATTTTGTGTTTAATGAGAATGAATTTACTGATTTTTCTTTTTTTTTTATGTCTTTTCTGCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTATGTATCAAACTTAATCTATAAACCTTTAGACGTGTGTTGTTGTGCTACTTGGCAAATTAGAATTAGAACTGCCTTGCTAATATCTTTCTTTCCGATGCAGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGTCAGTATTCCCCCTACTTCACTTGGCTACATACTGATGTTTCTTCCTGCCATGTCTATTGGATTCAATTTTGCCTCTAGATCTAAGAGAAATTTCTGTTTCCCTCACCACAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAAGA
  3   1   2       ext Egg  5g3  in                    TEgg036b09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCNCGCTGCATTAGACTGCTGTGTGGAACTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG60409.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCACNATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGATTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTG
  5   1   2       add Tad5                                 XZT31760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTATGTATCAAACTTAATCTATAAACCTTTAGACGTGTGTTGTTGTGCTACTTGGCAAATTAGAATTAGAACTGCCTTGCTAATATCTTTCTTTCCGATGCAGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGTCAGTATTCCCCCTACTTCACTTGGCTACATACTGATGTTTCTTCCTGCCATGTCTATTGGATTCAATTTTGCCTCTAGATCTAAGAGAAATTTCTGTTTCCCTCACCACAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGGTGAGACCTAGAGACGAGTTCATCATAGTAATGGCATGGGAATGAATGGCAGTTAAAACAGTTTTCAGCACATGTAATAATTAGC
  5   1   3        nb Ski1      in                        CABJ10724.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGNAGGTGCTTGTGCTGTTCCA
  5   1   3        nb Liv1      in                        CAAR10867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCGATTCGGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGAAGGTGCTTGTGCTGTTCCA
  5   1   3        nb HdA       in                  THdA038a17.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATNCAGACCACAGCTATGAATTAAAGAGCTTATTCCTTG
  5   1   3        nb HdA       in                   THdA038a18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCNATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGANAGTTGAGGCGTGAAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCC
  5   1   3        nb Sto1      in                         CABG8171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCCTGTGTACATATCCTGCCGCATNCAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAA
  5   1   3        nb Te3       in                        CAAM14192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTG
  5   1   3        nb Mus1      in                         CABH8265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATCCAGAAATCCAAGACTTCTGTGGCAACACCNGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATTAAATGGCTCATAAATACACTGTGTTGAGGACCTGA
  5   1   3        nb Liv1      in                          CAAR528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGC
  3   1   3        nb Int1      in                        CAAP13161.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTGGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAA
  5   1   3        nb Mus1      in                         CABH1286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGC
  5  -1   3        nb Int1      in                        CAAP14503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAACTAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCCTCGTGCCGAATTG
  5  -1   3        nb Hrt1      out                       CAAQ10230.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTA
  3   1   3        nb Ski1 5g3  in                         CABJ3292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTAT
  3   1   3        nb Liv1      in                        CAAR10867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTGCAATTTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAANA
  3   1   2       add Fat1      in                         CABC1202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGTATAAATTAGCCTAATGTTAAAGAATTTTAATAATCTGTGGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   3        nb Ski1 5g3  in                         CABJ5894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   3        nb Int1 5g3  in                        CAAP12866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGCCCTCTCGCCCTAT
  5   1   3        nb Tail      out                        CBSW7970.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTCCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTT
  5  -1   3        nb Liv1      in                         CAAR5684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTGCAAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   3        nb Lun1      in                        CABD10726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAAC
  3   1   3        nb Int1 5g3  in                        CAAP12140.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTTT
  3   1   3        nb Hrt1 5g3  in                         CAAQ8897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  5   1   3        nb Gas8      in                          st20n01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAA
  3   1   3        nb Fat1 5g3  in                         CABC4977.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   3        nb Liv1 5g3  in                         CAAR3777.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTGTGGAAAATCTCATTATAAGGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   4      seed Ski1 5g3  in                         CABJ3201.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   3        nb Ovi1      in                         CABI1798.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3  -1   3        nb Spl1      in                         CABK4734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAAATAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTA
  3   1   3        nb Mus1      in                         CABH1286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATCTCATTATAGGGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAANA
  3   1   3        nb Mus1      in                         CABH8265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   2       add Int1      in                        CAAP10708.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAANAA
  3   1   2       add Fat1      in                         CABC7437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  3   1   2       ext Lun1      in                         CABD8198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCC
  3   1   3        nb Ski1      in                        CABJ10724.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATTAATAGGGGGGCTGATATAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAG
  3   1   3        nb Sto1      in                         CABG8171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAATAAGGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  3   1   3        nb Ski1 5g3  in                         CABJ8728.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGACCCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  3   1   3        nb HdA       in                    THdA038a17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTTATAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb HdA  5g3  in                    THdA020f01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATAAGGGGGCTGATATAAATGCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCAGGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGATTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTAGTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGTTGTTCCATGGTGACCGATGTTGTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTTTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATTTTTATATAAAAAAAAAAAAAAAAAGC
  3   1   3        nb HdA       in                    THdA038a18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTTTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATTAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Lun1      in                         CABD1989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   3        nb Te3       in                        CAAM14192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGGGGCTGATATAAATGCCCAGGAGCCTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   3        nb Mus1 5g3  in                         CABH4393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   3        nb TpA  5x3  out                   TTpA023a11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATTAAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA  5g3  in                   TTpA069n09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATATAAATGCCCAGGAGCCTGNCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTATATAAAAAAAAAAAAAAAAA
  3   1   3        nb Ski1 5g3  in                         CABJ4250.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  5   1   3        nb Gas7                                 XZG59889.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTA
  3   1   2       add Liv1 5g3  in                         CAAR5635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  5  -1   3        nb Spl1      in                         CABK4734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAG
  3   1   3        nb Lun1      in                        CABD13589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   3        nb Neu  FL   in                    TNeu099d12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGGAGATTATTTTTATATGCAAAGTTTNATATTTTATATAAAAAAAAAAAAAAAAA
  3   1   3        nb Fat1 5g3  in                         CABC1868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGCCT
  5  -1   2       add Fat1      in                        CABC11449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   3        nb Gas8      in                          st20n01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAA
  3   1   2       ext Spl2 5g3  in                        CBSS2231.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  3   1   3        nb Liv1      in                          CAAR528.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  3   1   3        nb Ovi1      in                         CABI4501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  5   1   3        nb Ovi1      in                         CABI4501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAAAAAAAAAA
  3   1   2       ext Fat1      in                         CABC9517.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  5   1   2       ext Fat1      in                         CABC9517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                 XZG57132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCAT
  3   1   3        nb BrSp                             EC2BBA31DE08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTCCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAA
  3   1   3        nb Spl2 5g3  in                        CBSS8300.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  5   1   3        nb Spl2      in                        CBSS4131.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAANAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAAAAAAA
  3   1   3        nb Spl2      in                        CBSS4131.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   3        nb Thy1 5g3  in                        CBST4490.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCC
  3   1   3        nb Spl2 5g3  in                        CBSS8619.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  3   1   3        nb Int1 5g3  in                         CAAP3363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCC
  3   1   3        nb Thy1 5g3  in                        CBST4979.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCC
  3   1   3        nb Ovi1      in                         CABI1238.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGTGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   3        nb Thy1 5g3  in                       CBST10058.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAAAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   2       add Thy1      in                       CBST13148.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCATGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAGA
  3   1   3        nb Thy1 5g3  in                        CBST9648.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACACNAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  3   1   3        nb Spl2 5g3  in                        CBSS6719.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   3        nb Spl2 5g3  in                        CBSS6910.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCATGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   3        nb Spl2 5g3  in                        CBSS9811.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCATGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  3   1   3        nb Spl2 5g3  in                       CBSS10608.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCT
  5   1   2       add Lun1      in                         CABD6299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTACCTTCCAGAGAGCGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGTCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGTCAGAGAGCTGATTGATGAAATGGACTCCACTCTGTTTATAGTGCAAATAAAGTACTGAGAAGCTTAGACCCCGCCGAATGACTTTGT
  3   1   3        nb Spl2                                CBSS9882.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAGGAAAGGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   3        nb Gas1 FL   in                    IMAGE:5309348.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAAAAAAAAAAAAAAAAG
  5  -1   3        nb TpA       out                  TTpA056g03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCATCAAGACCACTGTTATGAATTAAAGAGGTTATTCCTTGAGCAGATAAAGAGAGGATGGTGCAGAAGGAACTCTAATCTGTCATTCACGTCATCGTGAGGCAGGGTGACCAATACCATGATTTCGACAATGCCCTTTAATGCCAATATGAAATAATTGGTTCATAAATACATTGGGTTGAGGACCGGAGTAATTATAGCCAGAGAGCGGATTGTTAATATAAAATACACACGGTATATAGTGTAAATAAAGTACGGAGATTATTTTTATAAGCAAAGTTTCTATTTTATATAAAAAAGAAGAAAAGAAAAAAAATATATAATTAATTGTTTCCCAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABC4240.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGGTGAGACCTAGAGACGAGTTCATCATAGTAATGGCATGGGAATGAATGGCAGTTAAACCAGTTTCAAGCACATGTAATAATTAGCCTAATGTTAAAGAATTTTTAATAATCTGTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
                                                  Xt7.1-CHK-1008274642                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGGTGAGACCTAGAGACGAGTTCATCATAGTAATGGCATGGGAATGAATGGCAGTTAAACCAGTTTCAAGCACATGTAATAATTAGCCTAATGTTAAAGAATTTTTAATAATCTGTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCC
  5   1   2       ext Tad5      in                         XZT38922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGGTGAGACCTAGAGACGAGTTCATCATAGTAATGGCATGGGAATGAATGGCAGTTAAACCAGTTTCAAGCACATGTAATAATTAGCCTAATGTTAAAGAATTTTTAATAATCTGTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAAGTTGAGCGTGNAGGTGCTTGTGCTGTTTCATGGTGACCGATGTTCTA
  5   1   2       ext Tad5      in                         XZT33337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGGTGAGACCTAGAGACGAGTTCATCATAGTAATGGCATGGGAATGAATGGCAGTTAAACCAGTTTCAAGCACATGTAATAATTAGCCTAATGTTAAAGAATTTTTAATAATCTGTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTA
  5   1   4      seed Fat1      in                        CABC11170.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGGTGAGACCTAGAGACGAGTTCATCATAGTAATGGCATGGGAATGAATGGCAGTTAAACCAGTTTCAAGCACATGTAATAATTAGCCTAATGTTAAAGAATTTTTAATAATCTGTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGANAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCCTGTGTACATATCCTGCCGCATNCAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGC
  3   1   2       ext Tad5      in                         XZT38922.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCATGGAAATGAATGGCAGTTAAACCAGTTTCAAGCACATGTAATATTTAGCCTAATGTAAAGAATTTTTAATAATCTGTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATAT
  5   1   2       ext Fat1      in                         CABC4240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTAGCCTAATGTTAAAGAATTTTTAATAATCTGTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTA
  3   1   4      seed Fat1      in                        CABC11170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAATAATCTGTTGGGTTGTGCAGGCCCTAGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCC
  3   1   2       ext Fat1      in                         CABC4240.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCAGTTTGGGCAGCTAAAATAAAATAAAGCTTTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTATATAAAAAAAAGAAAAGAAAAAAAATAAATAAATAATTGTTTCCAAATCC
  3   1   2       ext Tad5      in                         XZT33337.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCAGTTTGGGCAGCTAAAATAAAATAAAGCATTTAGGGTGAGGCAGGGATGAGATTTGGCAGGGGCTACGGAGACTGATAAAACCATAAACCCATCCATTTTTAGATTAGTGATCATCTTCTTCCTTTTAAGTTAGAAAAAAGTGGGTTCAGTAGCAACCCCTGAGTTATGTTTTGGTCCAACATGTAACTCTCTTGCAATAAAGTTGTCGCTTAATAAGGTTTATGTATAACAATTTTTGGCTCTAAATAGTTTTCTTTCTCTCTTTTGTCTAACAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAGACTGCTGTGTGTGAACTAAAAAAAAGAAACTATAAGGACAGACTCTCATTACTAGAGGACAGCACTGGAGCCAGTGACTTCGGGGTAGAAAAGGATCCTCTGAAAGTTGAGGCGTGGAGGTGCTTGTGCTGTTCCATGGTGACCGATGTTCTACACGAGAAGCTTCCTGTGTTACATATCCTGCCGCATCAAGACCACAGCTATGAATTAAAGAGCTTATTCCTTGAGCAGATAAAGAGAGGATGCTGCAGAAGGAACTCTAATCTGTCATTAACATCATTGTGAGGCAGGGCGACCAATACCATGATACTGACAATGCCCTTCAATGCCAACATGAAATAAATGGCTCATAAATACACTGTGTTGAGGACCTGACTAATTATAGCCAGAGAGCAGATTGTTAAAATAAACTACACACTGTATATAGTGTAAATAAAGTACAGAGATTATTTTTATATGCAAAGTTTATATTTTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)