Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 09 Aug 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 97%

 1012070723 Xt7.1-TEgg020g15.3.5 - 153 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               4     4     4     5     4     5     4     5     3     5     4     5     3     4     3     4     3     4     3     5     3     5     3     5     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     7     3     7     3     7     3    10     5    13    11    18    12    20    13    22    13    26    14    28    20    33    24    38    26    41    28    43    28    46    28    46    28    46    28    46    27    45    37    46    39    48    39    48    41    51    41    51    42    51    42    53    44    54    42    53    43    53    43    53    44    54    45    55    45    55    45    55    45    55    45    55    45    55    45    55    45    56    45    56    45    56    45    57    45    57    45    56    47    56    47    56    46    55    46    56    47    57    46    57    48    57    48    57    45    52    45    51    44    50    44    50    43    49    43    49    43    49    43    49    41    50    40    49    41    50    44    52    43    51    42    50    43    52    43    52    42    52    37    48    38    48    36    47    36    46    31    42    29    39    33    39    35    38    33    35    28    30    27    30    28    30    28    30    29    31    29    30    29    29    27    27    27    27    25    25    22    23    22    23    21    22    21    22    20    23    22    24    23    24    20    21    20    21    19    20    19    21    19    21    18    20    18    20    18    20    19    21    19    23    19    23    20    24    17    23    20    22    20    22    21    23    21    23    23    25    25    27    25    27    25    27    45    47    51    53    53    57    53    56    56    59    59    61    60    65    61    66    61    67    63    69    63    68    63    68    62    67    62    67    62    66    62    66    63    67    64    69    64    69    65    70    65    70    65    70    65    70    64    70    66    71    67    71    69    73    67    72    68    72    68    72    68    73    68    73    68    73    66    72    67    75    68    75    66    73    67    73    67    73    68    74    65    72    65    72    66    72    66    72    64    71    64    71    65    71    64    69    66    71    63    70    65    71    61    70    60    70    62    71    61    70    62    70    61    69    60    69    60    68    59    67    60    68    59    66    58    66    57    65    56    64    54    63    51    62    12    31    14    21     5     6     5     5     5     5     5     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCACAGACTTGTCAAGGTATTTTCTGCTTAAACACAGTTGGCATTACACATTCTGGCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATCTCAGCTGCTGCTTGGCATTACACATGGTGGAGTCATGCTTGTGTACAAATGCTTGCCCAAAAATCTCTCATGCTCATCACTATTAGTTTTTGTAGCTTCCATAGACATTTTGGAACTTGGCAGAGCCTGTTCCAGTTGAAGATATATTATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCTTATGTATGCAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTGTATTTGTTAGAGATGTAACAGCATTTCAGTATATAGTGCTCATTTTCCCTTTTGGTGTATGGGAAGTTGTCATTAGATGCACTGCTAAAAGGGTGGCAACTATACATTAACAGGACAAATTACTTGTGCTGAGTGCATGTAACCTTTAAATACCTTATCCCCACTTTTGGTACAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATTAAAAAGAAAAAAAGCTTTAAAAAAAGGGAATCAAAATGTTTAAGAGAATCCTAAATAATTTAAGACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGCAGTTATTCCATCAGCAGCCACATGTCATGCAATCTGCTAAATTCTGTCCTGCAACCAAATCTCCCTGTTGCTTCAGAAATGTCATATGTATGGCCAGCTTAATGTGCATTCTGTGTTTCGGGTGGTACCTTATAACAGACTTGGCATAGTGATCTATCATGTACAAGCTTCTTTAACTGTTTTCACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCTTGTCAGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------A-
                                               BLH ATG     395     748                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN     395     228                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH OVR     395     415                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               EST CLI     368       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               ORF LNG     395      52                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 1e-009     BAC57516.1 beta-transducin repeat-containing homologue protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Sc ---- 4e-011     NP_010007.1 general repressor of transcription (with Cyc8p); mediates glucose repression;Tup1p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Gg ---- 2e-018     NP_001006198.1 similar to Zgc:56591 protein [Gallus gallus] -----------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Bf ---- 1e-020     AAM18868.1 unknown [Branchiostoma floridae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---= 6e-079     NP_611494.1 CG9945-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 2e-085     NP_492125.1 WD repeat domain 23 (60.3 kD) (1I177) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 2e-161     XP_782058.2 PREDICTED: similar to WD repeat domain 23 [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 0          NP_001026845.1 hypothetical protein LOC567578 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 0          NP_598495.1 WD repeat domain 23 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 0          NP_079506.3 WD repeat domain 23 isoform 1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 0          AAH45232.1 Similar to RIKEN cDNA 0710008A13 gene [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 0          NP_001080744.1 WD repeat domain 23 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 0          AAH75264.1 WD repeat domain 23 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg020g15.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------TAA---TGA------------TAA---TGA------------------ATGTAA---------------TGA---------TAG---------------------TAAATG------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------TGA------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATAG---------------------------------------------TGA---TGA---------------TAG------------------------------------ATGTGA---------------------------------------------------------------------------------------------------------ATG---------------TAA---------------TAA---------TAA---TAG---------ATG------ATG------------------------------------------------------ATG------------------------------------TGATAA------------ATG---TAA---ATG------------------------------------ATG---------------TAGTGA------------------------------------------TAG---------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  3   1   1       add Tad5 5x   in                         XZT46470.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGGTAGTTACGTCATGAAACCAGCTTATAAATGAATGCATTACTTAATGAATGTGTAATTGAAATAAAAAGTCTTTGCAGTAGATACTCTGTGATGATGTCCAACATCCNCATTACAGCAAACCAACCACCGCTGTACAGACCTCACTTTTTGCATGGGGACATTATTGTGTTGAAACAGGGCCAAAAGGGCCTTCCCAGACTATTGCCACAAAGTAGGAAGCACAGACTTGTCAAGGTATTTTCTGCTTAAACACAGTTGGCATTACACATTCTGGCAGGTAGCATTCTCTTGACATCTGCCAGACCCAGCTATCAGTCAACCAGATGGTAAAGGTTAAGCCTCGCTCCAGAAAACACATTTCCACTTCTCCAGAATTTAAGGAAGGCACCATTTTATTCTATCTCAGCTGCTGCTTGGCATTACACATGGTGGAGTCATGCTTGTGTACAAATGCTTGCCCAAAAATCTCTCATGCTCATCACTATTAGTTTTTGTAGCTTCCATAGACATTTTGGAACTTGGCAGAGCCTGTTCCAGTTGAAGATATATTATTTTTAAAAAAGCATATCTGGATATACATGTATAAATGCGTTGCTTGATATGTGGGGTTGAGTGTTGTATTTGTTAGAGATGTAACAGCATTTCAGTATATAGTGCTCATTTTCCCTTTTGGTGTATGGGAAGTTGTCATTAGATGCACTGCTAAAAGGGTGGCAACTATACATTAACAGGACAAATTACTTGTGCTGAGTGCATGTAACCTTTAAATACCTTATCCCCACTTTTGGTACAGGTGATT
  5   1   1       add Bone      in                        CBTC5238.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTCGCTCCAGAAAACACATTTCCACTTCTCCAGAATTTAAGGAAGGCACCATTTTATTCTATCTCAGCTGCTGCTTGGCATTACACATGGTGGAGTCATGCTTGTGTACAAATGCTTGCCCAAAAATCTCTCATGCTCATCACTATTAGTTTTTGTAGCTTCCATAGACATTTTGGAACTTGGCAGAGCCTGTTCCAGTTGAAGATATATTATTTTTAAAAAAGCATATCTGGATATACATGTATAAATGCGTTGCTTGATATGTGGGGTGAGTGTTGTATTTGTTAGAGATGTAACAGCATTTCAGTATATAGTGCTCATTTTCCCTTTTGGTGTATGGGAAGTTGTCATTAGATGCACTGCTAAAAGGGTGGCAACTATACATTAACAGGACAAATTACTTGTGCTGAGTGCATGTAACCTTTAAATACCTTATCCCCACTTTTGGTACAGGTGATT
  3   1   1       add Bone      in                        CBTC5238.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTCGCTCCAGAAAACACATTTCCACTTCTCCAGAATTTAAGGAAGGCACCATTTTATTCTATCTCAGCTGCTGCTTGGCATTACACATGGTGGAGTCATGCTTGTGTACAAATGCTTGCCCAAAAATCTCTCATGCTCATCACTATTAGTTTTTGTAGCTTCCATAGACATTTTGGAACTTGGCAGAGCCTGTTCCAGTTGAAGATATATTATTTTTAAAAAAGCATATCTGGATATACATGTATAAATGCGTTGCTTGATATGTGGGGTGAGTGTTGTATTTGTTAGAGATGTAACAGCATTTCAGTATATAGTGCTCATTTTCCCTTTTGGTGTATGGGAAGTTGTCATTAGATGCACTGCTAAAAGGGTGGCAACTATACATTAACAGGACAAATTACTTGTGCTGAGTGCATGTAACCTTTAAATACCTTATCCCCACTTTTGGTACAGGTGATTAAAAG
  3   1   4      seed Lun1      in                         CABD1295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   2       ext Ski1      in                         CABJ4652.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  5   1   0       chi Ovi1      in                         CABI1332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTATTTATATCTGAGAGCCTGCCGAAAATTATAGATGGCCCACATGAGCATATTCGTACTTTCTGGGTTCAAACAATTCTGGTCATCAACCTCTGCCCTAGAGAATTCTTCATTTTAATTACCTACTTGCAGCCCTTCAAGATTTCTCCTAAATTATTCTTGAGCAGATTTGCAAAACTTTGAGCTATTGTGCACACTACCTCTACTACCCACATGTCAATACTGCATGTAAACATACCCACTGCCCTCAAACTTGCTTCCCCACTGAACCCTAGTTCTTTCCCATCCCTTGTGTGTGAGGTATGTCTGTCCTGAGAGTTGGTGTCCTTTTCCATCTTAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTA
  5   1   2       add In60 5g                         IMAGE:8952234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCAAAGTTTTTTTTGAAGATAACTCCATATTAATCGCCCTTGGAGCTGGCAGTTCTTAGTACAAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCTCCCAATGGATCTGTCTTTATGTCAGCATGTCAGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGCTCGGGATGTTGGCTGGAGTGTCTTGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCTCAGAGCGTCGTTTTGCTGTTTTTCTTCTCACTGTATTCTTTCTGATGGACGAAAAATTCTGCATGC
  5   1   2       ext Egg  5g3  in                   TEgg007l10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCATTAACAATGTTCTTGTCCGTGTGTTTTTTTTTACTGATATTTTGTTTACTGTATATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAAGATCAAAA
  5   1   2   10  ext Tail 5g3  in                        CBSW12129.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTTTACTGATATTTTGTTTACTGTATATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAA
  5   1   3   22   nb Tad5 5g                              XZT16966.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTTACTGTATATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTAGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACG
  5   1   3   10   nb Limb 5g3  in                        CBSU7764.fwd .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTTACTGTATATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTAC
  5   1   3   20   nb Spl1 5g                              CABK8383.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTACTGTATATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGA
  5   1   3   12   nb Gas7 5g3  in                         XZG54640.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGTATATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGGTTTTTCTCT
  5   1   2       add In62 5g                         IMAGE:8953900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATATTCGCAGGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAAGCTCGGGATGTTGGCTGGAGTGTCTTGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTGCTGTTTTTCTCTCACTGTATCTCTGATGACGAGAAATTCTGGAGGCATGATAGATGTGTTATGTGTACGACGTGAGCGATGTCGAACGCTCAGATGGTTCATGAAGACGAGTGATGCTGTCTCTTGCTGAATGACAGTGCCCATATAGGCCTACCTCAGGGG
  5   1   3   14   nb Brn4 5g3  in                         CAAL8919.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCCATGATAGATGTGTTTATGTGTACGAC
  5   1   0       chi Tad5 5x   in                         XZT46470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGTAACAAGACCCCTGACATGTCCTCCATAAACTTGTCCAACTATATTCTTAGCAAACACTGAAGCGAAGGTAGGATCTTACTTATGGCGCACATTGCTCAGTGTTCGGTTTTAGGGTTCTTTTATAGACAGGTAAGGGCTTTAATAGATAATGAGACAGACAATAAATTAAATACTTCTGGAATCTTTTAGCTCAGCAGTATTGTATAATAGCCACTAGGTGGTCATATAGACTAGGCATCATACTGTAAAGCAGAATAGAATTATACTGCAGAGAGGTGGAATATGTAGCATGGTCATTACCAGAAAAGTTGTTTTTAACCTTAAAGTTGTTTTAATCCTTTACCTGTCACCCATCATAGAATCATCATAGAATCTACTGCTTCGTCACGAAAGTTCCATCATGCTGGCCCCAAAGATTCTACATTTTTGTTGTTTCTATTTGAAGGGTGCAAGGTGTTTACTGGCAACATGCAACACGGTTAGATCAAAAACCTGTGCAACAGAAAGGGTTAAATAGTGTCTCTGTTACATTATTTTAGATCATTTGTAGGTAGTTGCCAGTGTCATGGCATGATACTTTATACATCCAGCAGTTGGGTTCAAATGTGTTGCTTATGTTTTGTTAAATTGAAAAATAATCAAGGAGCAAATCAGTGCAGAGTTATTTTAGCATTTTTCAATCATACGA
  5   1   3        nb AbdN FL   in                       IMAGE:6998287                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCAACN
  5   1   3        nb Te5       in                         CAAO3992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGG
  5   1   2       ext TpA       in                   TTpA069j23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACCGAAGTAGTAGCAGGTGCAGTGAGGGTGTGGGAAACTCCGGTGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCACACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGATGTT
  5   1   3        nb Mus1      ?                          CABH1208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTT
  5   1   2       add In66                            IMAGE:8963095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGCAGTGCAGGAGGCCGTTTTGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCATGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTGCTGTTTTTTTCTCCTCACTGTATCTCTGATGACGAGAAATTCTGGCAGGGCATGATAGATGTGTTTATGTGTACGACCGTGAGCAGATGGTTCGACGCTCAGGATTGTTCCCATGAGGAACGAATTGGAATGCCTGCCCTCCTTGGGCTGAGTGACA
  5   1   3        nb Te1       in                         CBWN9594.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCGTACAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCG
  5   1   2       ext Spl1      in                         CABK9866.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGT
  5   1   3        nb Liv1      in                         CAAR8511.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTG
  5   1   4      seed Spl1      in                          CABK594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGC
  5   1   3        nb Lun1      in                         CABD3654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAAGAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATG
  5   1   3        nb Fat1      in                         CABC5716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCTAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTAC
  5   1   3        nb Hrt1      in                        CAAQ10207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGC
  5   1   3        nb Liv1      in                         CAAR3987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACG
  5   1   3        nb Hrt1      in                          CAAQ542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACG
  5   1   2       add Int1      in                         CAAP8189.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCAGTGAGTATCAAGGGGCTTGTATGTTTGATGGGTGATTATTTGTCATGATAACTGTCTTTCTGTCTTCTTTTAGTTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGGTACTTTGTGTGA
  5   1   3        nb Tad5                                 XZT48249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTCCGCCTAGAGTCTACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGTGCCAATGATAGATGTGTTTATGTGTACGAC
  5   1   0       chi Te3                                  CAAM2144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACT
  5   1   2       ext Lun1      in                        CABD11315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGTACTGGCGTATCTTCTGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGAC
  5   1   0       chi Lun1      in                         CABD6266.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGGTACTTTGTGTGAGAAAAATGTCCACTAGTAGTTTTATATTTTGTTATCTTAACCCACTTCAGTTTCAGTTTTGTGCCATTCTGTGTCTGCTTTTTTTTTCTTTTCATCCTTGCCACTAAATTCTTTTTATAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGTAAGTATATACGACAATTGCTTGGTTGACT
  5   1   2       add Fat1 5g3  in                         CABC2269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTA
  5   1   3        nb Egg                            TEgg140l19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACG
  5   1   3        nb Gas                            TGas047g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTANGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAAGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCANAGCGTCGTTTTGCTGTGTTTTCTCTCACTGTATCTTCTGA
  5   1   3        nb TbA       in                   TTbA067h24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGATTATTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACTGTGCCTGGGAAGGCTGCTTAAGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCTACTCCCGAAAGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCACGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAAGCTCGGGATGTTGGCTGGAGTGTCTTGTATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTGATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAAAAATTTCTGGGAGGGGCCAATGATAAATGTGTTTATGTGTA
  5   1   3        nb Brn4      in                         CAAL9719.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACC
  5   1   2       add In54                            IMAGE:8946973.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTTTTTTGGCGGACCTTTTTGATAAAAAATCGTCCCCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACGCCGACCATGCGAGAGATGATCCCAAACAGTGGGATATTAGCTGACATCAGATGCATCACTTCATACTAGCAAGGAATGCTCGGTACTAACTATCACTCAAAGGATCGAGTATAAGCTTTGGGATATATCCAGGAGAGAT
  5   1   3        nb Ski1      in                        CABJ10965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATNCAGATGGCATCACTTTCATACATAGC
  5   1   3        nb HdA                           THdA013g03.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAATACAAAGCACACTAAGACAACATATCATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCGTACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCACCTATGGATCTGTCTTTATGTCAACATGTCA
  5   1   3        nb Gas7      in                         XZG58693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGA
  5   1   3        nb Hrt1      in                         CAAQ4003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAA
  5   1   3        nb Int1      in                         CAAP6284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCA
  5   1   2       add Ovi1      in                         CABI6185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCTCAGTGAGTATCAAGGGGCTTGTATGTTTGATGGGTGATTATTTGTCATGATAACTGTCTTTCTGTCTTCTTTTAGTTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCANGTTCCCAAGAGAGCTCTC
  5   1   2       add In62                            IMAGE:8952894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTAGTAAAACACCGGACCCCACCCTATTCATATTCGTCCCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGAGATTTTCAGGGCCAGAAAGACTTGAGGCCTCACGAAGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGTTCCCAAGAGAGCTCTCAGAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTAACATACACTGATTCGTGTCGCTTCTCTCCTGCATACACCACTGCAGCAGTTGTGTACAGTGCTGTTCCACAGGTCGAGTGTAGTTATGATTTGGTACGTTCGATCTGAGACCTGACATTCCAAGCCATGCTGAAAGATGTTAGCTTGGATCCCAGTGAG
  3  -1   3        nb Int1      in                         CAAP1365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCGTGTCTGG
  5   1   2       add In63                            IMAGE:8957373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATCCCTTTTTTTTAACATAATCTTAAAAATAATTCGCCCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAA
  5   1   3        nb TbA       out                  TTbA046i15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCACAGCGTCGTTTTGCTGTTTTTTCTCTCACTGGATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATACATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCCATATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATACTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAGGATGGCATCACTTTCATACCTAGCACGGGGGATGCTCGTTACTTACTATCCA
  5   1   3        nb Gas7      in                          XZG7291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTG
  5   1   3        nb Egg       in                   TEgg020g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCT
  5   1   0       chi AbdN                               IMAGE:7005976                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCATGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTTGTTAACGGGTCAGATAGTGGAAGAAACTGACCAATCCCAAAGCCTTGCCGTGAGAAGATGTTAGCCTGGGCATTCCATGTTGTAGAAACACAGCCTTGGGTCAGCAGCCTCCTTGGGGGACCGGGAAAAACTTCCCCGGTGTCCTGGGGGAAAACATTCCGCCCCCGGGGGCTTTGAAATTTTTTTTTACCCCCCCTATAAAAAGAAATATTTTGGGCCGGTATATCCCCCCCCC
  5   1   2       ext HdA  5g3  in                  THdA036e16.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTTCATTCTGCCTGTTTTGCCACAACATATGCAAATC
  3   1   3        nb Int1      in                         CAAP6284.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATGAACCAAG
  5   1   3        nb Gas7 5g3  in                         XZG22280.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATTAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCGGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCT
  5   1   2       ext Ovi1 5g3  in                         CABI5580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCCAGGAAAGTAG
  5   1   3        nb Liv1      in                         CAAR8134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCGATTCGTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGCGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGG
  5   1   2       ext Ski1      in                         CABJ3458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTG
  3   1   3        nb Egg       in                    TEgg020g15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAAAAAAAAAAAA
  3  -1   3        nb Hrt1      in                         CAAQ7809.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTT
  5  -1   3        nb Hrt1      in                         CAAQ7809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCNCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACT
  5  -1   3        nb Int1      in                         CAAP1365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGTTCNCAAGAGAGCTCTCAGGAAGAAACGTTGCCAGGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTA
  5   1   0       chi Tad0                               IMAGE:6983935                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCACAACATATGCAAATCCCCGAGTGCTAGTTTCAGAATTACCTTAAATTGTATGTATAATTTATTGCACATTGATGTCCTTATTTTTTCTTTTTAAGGAAAATGACCTATTGTGACTCTAGGACGATCTGAATTTATTGGCTGAGGGTGTTTTAAAACTACTTGCGAAAACAAACATAATATAAAAATACGTTTGAGTAN
  5   1   3        nb TbA       in                   TTbA065n04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTACAACAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTACATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGNGGTGAATGACTGATACAAAGATATTTTGATGTGCT
  3   1   2       add Ovi1      in                         CABI6185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCAGGAGACACTTCCTTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATACGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAAAAAACCTC
  3   1   2       ext Lun1      in                        CABD11315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAACCTCT
  3   1   2       add Int1      in                         CAAP8189.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTG
  3   1   2       ext Spl1      in                         CABK9866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   2       add Ovi1      in                         CABI1332.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGGTTTCTCCTCTCGCCCTATA
  5  -1   3        nb Int1      out                        CAAP9423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTAAAAAACGAATCGATGG
  3   1   3        nb Hrt1      in                        CAAQ10207.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   3        nb Hrt1      in                         CAAQ4003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   3        nb Liv1      in                         CAAR3987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   3        nb Liv1      in                         CAAR8134.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGCGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGCTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   3        nb Liv1      in                         CAAR8511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   3        nb Fat1      in                         CABC5716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   3        nb Lun1      in                         CABD3654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAT
  3   1   2       add Lun1      in                         CABD6266.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAAAAACCTCTCGCC
  3   1   2       ext Ovi1 5g3  in                         CABI5580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   3        nb Ski1      in                        CABJ10965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCACGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   2       ext Ski1      in                         CABJ3458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   4      seed Spl1      in                          CABK594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   3        nb Gas7      in                         XZG58693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTCCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   2       ext TpA       in                   TTpA069j23.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTATATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Te5       in                         CAAO3992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   3        nb TbA       in                    TTbA065n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGATAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTACTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAAAAAAAAAAAAAAAAAA
  3   1   2       ext HdA  5g3  in                   THdA036e16.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTTTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Brn4      in                         CAAL9719.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   3        nb AbdN FL   in                       IMAGE:6998287                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCACCACTGCCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTAC
  3   1   2       add Fat1 5g3  in                         CABC2269.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCCCAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACCCTCATAATTGAACCAAGGAAAGTAGTGGACCCCATTTCAATTCTGCCTGTTTTGCCCCAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTTTCAACCTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Gas  5x3  out                   TGas094e16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg                            TEgg144g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGTTTGTGTACAGTGGCTGTTCCCAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTTGTAAACAGCATGGGGTGAATGACTGATAAAAGATATTTTTGATGTGCTACAGATGAATGCAGGGCTGTTACA
  3   1   3        nb Gas7 5g3  in                         XZG22280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCACAGGTCGAGTTGTAGTTTATGATTGTTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                          XZG7291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   3        nb TbA       in                    TTbA067h24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGTTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTTTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATTTCAGAGTGTTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTTTGTGCGGCACGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGATTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACTTGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGCGATATATAATATGGGGGCGGGGTTATTGTGTTTATGATTGCTTATAGGGTTCTGTAATAACCCTTTCTCAACCATTCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Tail 5g3  in                        CBSW12129.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATCCAAAAAAAAAAAAAAA
  5   1   2       ext Tad5      in                         XZT53966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGTCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATANACCTTTCTCANACATTCAAA
  5   1   3        nb Tbd1      in                        CBXT20305.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAAAAAAAAAAA
  3   1   3        nb Hrt1      in                          CAAQ542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   3        nb Limb 5g3  in                        CBSU7764.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   2       ext Tad5      in                         XZT53966.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGTCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACCCCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACACCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACTTTCAAAAAAAAAAAAAAAAAAAAAACC
  5   1   0       chi Limb      in                        CBSU4041.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATAACACCCCCCCATCCCCTTCACATAAAATATAATTACTTGCCAGGCACCCCCCCCCCCACAGCTCACATTGGTATCCGACTCTGAATGCGATGGCGCTTTTGTAGAGTGTGCGCGCTGACGTCACGTGCGCGCTGACGTCACGTGCGCGCTGACGTCACGTGCGCACCCGGAAGTATTCAAGCACACCGGTATGGGGGTATGTAGAAAATACATATCGGTTTCAAAAAAAACACCGGTGATCGGTTTTTACCGGTATACCGCCCAGCACTATATACACTCCTAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCCCAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTTCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAAGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAT
  3   1   0       chi Limb      in                        CBSU4041.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATAACACCCCCCCATCCCCTTCACATAAAATATAATTACTTGCCAGGCACCCCCCCCCCCACAGCTCACATTGGTATCCGACTCTGAATGCGATGGCGCTTTTGTAGAGTGTGCGCGCTGACGTCACGTGCGCGCTGACGTCACGTGCGCGCTGACGTCACGTGCGCACCCGGAAGTATTCAAGCACACCGGTATGGGGGTATGTAGAAAATACATATCGGTTTCAAAAAAAACACCGGTGATCGGTTTTTACCGGTATACCGCCCAGCACTATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTTCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAT
  3   1   3        nb Brn4 5g3  in                         CAAL8919.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCCCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCCCAATACTAGCTACCCAAGTGTGTCATGACAGTGATGTATTTGTGTCCCCTAGAAGAGAGAGGACTGGATCCAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTTTTATATATCCCCTCATAATTGACCCAAGGAAAGTAGTGGCCCCCATTTCAATTCTGCCTGTTTTGCCCCAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCCCTTTAAATATATGTTTAATTTTAGGGGAGAAGAATTTTAGATATGTCCATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATCCCCTTTGTGTTTGTAAAACACCATGGGGGGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATCCAGGGCTGTTCCATGTTAAGAAGAGGAAAGCCATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTTTCAACCCTTC
  3   1   2       ext Egg  5g3  in                    TEgg007l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG54640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCCCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCCCAATACTAGCTACCCAAGTGTGTCATGACAGTGATGTATTTGTGTGCCCTAGAAGAGAGAGGACTGGATCCAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATCCCCTCATAATTGACCCAAGGAAAGTAGTGGACCCCATTTCAATTCTCCCTGTTTTGCCCCAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCCCTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTCCATTTTAAGACGTGCAATTCCTTGGCATGACTTCTGTGCGGCATGTGTTTACATCCCCTTTGTGTTTGTAAACCACCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATCCAGGGCTGTTCCATGTTAAGAAGAGGAAAGCCATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAACCCTTTCTCAACCAAAAT
  3   1   3        nb Kid1      in                         CABA5245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAA
  5   1   3        nb Kid1      in                         CABA5245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAA
  3   1   3        nb Tbd1      in                        CBXT20305.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTCGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATGGGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAA
  3   1   3        nb Gas7      in                         XZG50558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACGCGTCCGGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATCCAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATCCACTCATAATTGACCCAAGGAAAGTAGTGGACCCCATTTCAATTCTGCCTGTTTTGCCCCAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCCCTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTCCATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATCCACTTTGTGTTTGTAAAACACCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATCCAGGGCTGTTCCATGTTAAGAAGAGGAAAGCCATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAACCAAAAAAAAAAAAAAAAAAAAAAAAAAT
  5   1   3        nb Gas7      in                         XZG50558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGGGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCN
  3   1   3        nb Hrt1      in                         CAAQ5276.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  5   1   3        nb Hrt1      in                         CAAQ5276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                         CBWN9594.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTATCATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTATCTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAAAAAAAAAAAAAA
  5   1   0       chi Te3       out                        CAAM1370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTCAGCCTTGCTTTTTTCCTGTGATATCTCTTCCAGAAAAATGATTTGTCCTGAGCATATAGCACTTGTCATCTTGTGGTTTATTAGCTTTTGTCTTTTAGATCATACTTTATAGTTAAGTATATTGTGAGCCAAAATTATATGGTGACTCTGGAAATTGTTTTGTCAAAAGGATGTGCAATGACTGTGGTCCAAAAAATCAATTCAAGACCCGTGCCAGAGAGTTTTAGTAGGGTAGTACAAAGGATGTGTGTGACTGGTACCTGCCAGTAGGTTATCAAGACCATTGTGGATCTGTTTGTGTTATGTGTGACTGGTGCCTGTAAAATATCTGACTGTGTTAATGTATAAGGTATGTGGAGCTTTGTTACTGGCACCTACCAGAGATTATACTGGACCTCTGATAGGTCCTTCAGACATCTATACTAGAGGGGCCTTGCACATATCTCTAAAGTCAAAGGCATGCTGGCACTTTTTCTTCTCTATTTTTTTTTTTTTTGTGTACAAATAATGGCTCTTTATTTTTTGTAGCAGCTGGTCAACTCCAGATTGTGGGTTAGTCCAAGTGCTGGCACAAGGGTGCTTCTAACAGCTGGTCAATGCCACAGCG
  5   1   2       ext Gas  5g                        TGas016h05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACGTTCTTGTCCGTGTGTTTTTTTTACTGATATTTTGTTTACTGTATATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGANAGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTAC
  5   1   3        nb Gas  5g   ?                    TGas094c14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGTTCTTGTCCGTGTGTTTTTTTTACTGATATTTTGTTTACTGTATATTGCAGTGATGGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACCGTGCCTGGGAGGGC
  5   1   2   12  ext Gas7 5g3  in                         XZG32445.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGTATGGGAACACGAAGTAGTAGCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGACAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTG
  5   1   2   14  ext Brn3 5g3  in                         CAAK8797.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACACGAAGTAGTATCAGTGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGNGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAAT
  5   1   4   10 seed Ovi1 5g3  in                        CABI12648.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGGCAGGAGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTG
  5   1   2       ext HdA  5g3  in                  THdA038g06.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGTGGGGAAACTCCGGGAGATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGANGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACT
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ3695.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTCTCCAGAAGACTCCCAAAACAACCTAGAGTCACGTGGTCTTCAGAATGATGATGATGAGGAGAACGTTGACCTGGCGCAGGGGACAAGTGCGATTAGTGCAGGGAGGGGGTCCTGCTAGCTTACACCTGGTGCAATCTTTGTCGGACTCAGATGATGATAACGACAGTGCCTGGGAGGGCTGCTTAGGAGACCGCTACATTCCTCCTGTTGATTCAGCCCCAGACACCACATCGCTGGATCAAAATCAGATCAGGACACAGACACTTTTGGCCACAGGAAGACAAAGCACACAAAGACAACATAACATCACACGTCTCCTATTGGAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCATTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGA
  5   1   2       ext In60                            IMAGE:8951921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAATGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTGGATGTGGCATTTACCCCGGATGGAGGACATTTTCTGTACTCCAGCTGGTCAGACTACATTCATATCTGTAATATATATGGAGATACTGAATCGCACACTGCCCTGGATCTGAGCCCCTCAGAGCGTCGTTTTGCTGTTTTTTCTCTCACTGTATCTTCTGATGGACGAGAAATTCTGGGAGGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCACGAGATTTTCAGGCCAGAAGACTTGAGGCCTCACGAAGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGTTCCCAGAGAGCTCTCAGAGAAACGTTTGCAGAGACACTTCCTATGACATACGGGGGCATGTGTCTACTACACTGATCGTGTCGCTTCTCTCCTGCATACCCACTGGCAGCAGTTGGTTACGTGCTGTCCACAAGTCGAGTGGTAGTTATGATTGTACGGTCAG
  3   1   2       ext Brn3 5g3  in                         CAAK8797.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATT
  3   1   3        nb Hrt1 5g3  in                         CAAQ3695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   4      seed Ovi1 5g3  in                        CABI12648.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTC
  3   1   2       ext HdA  5g3  in                    THdA038g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCATCCATTGTGAGAACAAGCTTGTCAGCAGTTTTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATTTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAAAAAAAAAAAAAAAAAAAGC
  3   1   2       ext Gas7 5g3  in                         XZG32445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGTGTCATGCCAGTGATGTATTTGTGTCCCCTAGAAGAGAGAGGCCTGGATCCAGTGTGTAGGGAAAAAAATGGGGGGTGCTAAATATCTCTGTGTGACCAAATTTTTTATATATCCCCTCATAATTGACCCAAGGAAAGTAGTGGCCCCCTTTTCATTTCTCCCTGTTTTCCCCCAACATATCCAATTCTCAGAGTGCTAATTTCAGAATCCCCTTTAAATATATGTTTAATTTTAGTGGGGAAGAATTTTAAATATGTCCTTTTTAAGCCGGGCAATTCCTTGCCATGATTTTTGTGCGCCATGTGTTTCCATCCCCTTTGTTTTTGTAAACCCCCATGGGGTGAATGCCTGATAAAAAGATTTTTTGATGTGTTAACAGATGAATCCAGGGCTTTTCCTTTTTAAGAAGAGGAAACCCATGGGGGATTTTAATAATTAGTGATATATAATAGGGGGGCGGGGTTCCTGTTTTTCTGATTGCTTATAGGCTTCTGTAAAAACCCTTTCCCAACCAAAAAAAAAAAAAAAAAGGAAACC
  5   1   4      seed Neu  FS   in                   TNeu097a03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGGGCTAATTTGGCTCCTTTGTGGTGTACAAGCAAAGGCGTAAACTTCGCACTGTGCATCACTGTGCAAGTACTATGTGAATGGTCACCTAAGGGGAGCAATTTTGCATTATTTAGCACATCCATAAGTTGTGTAAGTTATCCATACTGTTTTGGTGTATTTTTATTCTGTGATAGAATTGCCCGGTACGTGAAAATAAAGCAGTTGGACTGTCAAAAAAGTCTGGGAAAGGACAGGACCTTTAAACCTATAGATTTTCAATGCTAGTAAATTTTCCCCCCATTGTCATTGTTTCTTATGTATGCAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCAGTGAGTATCAAGGGGCTTGTGTGTTTGATGGGTGATTATTTGTCATGATAACTGTCTTTCTGTCTTCTTTTAGTTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGTAGAAATGGTGCCTTTAAGAAATTTCGCACTGTTAAGGCTCGGGATGTTGGCTGGAGTGTCTTG
  5   1   3        nb Neu       in                   TNeu110l04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGGGCTAATTTGGCTCCTTTGTGGTGTACAAGCAAAGGCGTAAACTTCGCACTGTGCATCACTGTGCAAGTACTATGTGAATGGTCACCTAAGGGGAGCAATTTTGCATTATTTAGCACATCCATAAGTTGTGTAAGTTATCCATACTGTTTTGGTGTATTTTTATTCTGTGATAGAATTGCCCGGTACGTGAAAATAAAGCAGTTGGACTGTCAAAAAAGTCTGGGAAAGGACAGGACCTTTAAACCTATAGATTTTCAATGCTAGTAAATTTTCCCCCCATTGTCATTGTTTCTTATGTATGCAGAGAGAGCGGGCAGGATGTGGATTTACTATGGGAGAGCGTTGTCGTGTAACATCTCAGTGAGTATCAAGGGGCTTGTGTGTTTGATGGGTGATTATTTGTCATGATAACTGTCTTTCTGTCTTCTTTTAGTTTCCTCCCGAATCATGTATGTGCCACAGACTCATACTCCCAGAAGGCTTTCTGTGGGGTGTATTCCCCCAATGGATCTGTCTTTATGTCAGCATGTCAGGATCAAAACATCCGCTTATATGATTGT
  5   1   2       add Tad5                                 XZT11469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCTCATGCTCATCACTATTAGTTTTTGTAGCTTCCATAGACATTTTGGAACTTGGCAGAGCCTGTTCCAGTTGAAGATATATTATTTTTAAAAAAGCATATCTGGATATACATGTATAAATGCGTTGCTTGATATGTGGGGTTGAGTGTTGTATTTGTTAGAGATGTAACAGCATTTCAGTATATAGTGCTCATTTTCCCTTTTGGTGTATGGGAAGTTGTCATTAGATGCACTGCTAAAAGGGTGGCAACTATACATTAACAGGACAAATTACTTGTGCTGAGTGCATGTAACCTTTAAATACCTTATCCCCACTTTTGGTACAGGTGATTAAAAAGAAAAAAAGCTTTAAAAAAAGGGAATCAAAATGTTTAAGAGAATCCTAAATAATTTAAGACAAGGGTCATTACAGGTGCAGTTATTCCATCAGCAGCCACATGTCATGCAATCTGCTAAATTCTGTCCTGCAACCAAATCTCCCTGTTGCTTCAGAAATGTCATATGTATGGCCAGCTTAATGTGCATTCTGTGTTTCGGGTGGTACCTTATAACAGACTTGGCATAGTGATCTATCATGTACAAGCTTCTTTAACTGTTTTCACAGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGT
  5   1   3        nb Lun1      in                        CABD10325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCATTTTCCCTTTTGGTGTATGGGAAGTTGTCATTAGATGCACTGCTAAAAGGGTGGCAACTATACATTAACAGGACAAATTACTTGTGCTGAGTGCATGTAACCTTTAAATACCTTATCCCCACTTTTGGTACAGGTGATTAAAAAGAAAAAAAGCTTTAAAAAAAGGGAATCAAAATGTTTAAGAGAATCCTAAATAATTTAAGACAAGGGTCGTTACAGGTGCAGTTATTCCATCAGCAGCCACATGTCATGCAATCTGCTAAATTCTGTCCTGCAACCAAATCTCCCTGTTGCTTCAGAAATGTCATATGTATGGCCAGCTTAATGTGCATTCTGTGTTTCGGGTGGTACCTTATAACAGACTTGGCATAGTGATCTATCATGTACAAGCTTCTTTAACTGTTTTCACAGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCCAGAGAGCTCTC
  3  -1   2       ext Lun1      in                        CABD14459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAGTTGTCATTAGATGCACTGCTAAAAGGGTGGCAACTATACATTAACAGGACAAATTACTTGTGCTGAGTGCATGTAACCTTTAAATACCTTATCCCCACTTTTGGTACAGGTGATTAAAAAGAAAAAAAGCTTTAAAAAAAGGGAATCAAAATGTTTAAGAGAATCCTAAATAATTTAAGACAAGGGTCGTTACAGGTGCAGTTATTCCATCAGCAGCCACATGTCATGCAATCTGCTAAATTCTGTCCTGCAACCAAATCTCCCTGTTGCTTCAGAAATGTCATATGTATGGCCAGCTTAATGTGCATTCTGTGTTTCGGGTGGTACCTTATAACAGACTTGGCATAGTGATCTATCATGTACAAGCTTCTTTAACTGTTTTCACAGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGT
  3  -1   3        nb Fat1      in                        CABC10383.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAAATGTCATATGTATGGCCAGCTTAATGTGCATTCTGTGTTTCGGGTGGTACCTTATAACAGACTTGGCATAGTGATCTATCATGTACAAGCTTCTTTAACTGTTTTCACAGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCC
  5   1   2   10  ext Lun1 5g3  in                         CABD2830.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTAATGTGCATTCTGTGTTTCGGGTGGTACCTTATAACAGACTTGGCATAGTGATCTATCATGTACAAGCTTCTTTAACTGTTTTCACAGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGNGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACT
  5   1   2   10  ext Ski1 5g3  in                         CABJ3988.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATCGATTCAATTCGGCCGAGGTTTCACAGGGCCAATGATAGATGTGTTTATGTGTACGACCGTGAGCAGAATGTTCGAACGCTCAAGATTGTTTCCCATGAGGACGATGTGAATGCTGTCTCCTTTGCTGATGACAGTTGCCATATAGTCTACTCAGGGGGCGATGATGCGTTATGTAAAGTGTGGGACCGCCGAACCATGCGAGAAGATGATCCCAAACCAGTGGGGATATTAGCTGGACATCAAGATGGCATCACTTTCATACATAGCAAGGGGGATGCTCGTTACTTACTATCCAACTCAAAAGATCAGAGTATAAAGCTTTGGGATATCAGGAGATTTTCAGGGCCAGAAGGACTTGAGGCCTCACGAAGGGCAGTTACTCAGCAGAACTGGGACTACCGCTGGCAGCAGGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACA
  5  -1   3        nb Fat1      in                        CABC10383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGTTACTCAGCAGAACTGGGACTACGCTGGGCAGCAGTTCCCAAGAGAGCTCTCAGGAAGAAACGTTTGCCAGGAGACACTTCCCTAATGACATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCAGTGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTG
  3   1   4      seed Neu  FS   in                    TNeu097a03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATACCGGGGGCATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAAAAAAAAAAAAAAAAAA
  3   1   2       add Lun1      in                        CABD10070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATGGTGTCCTACATACACTGATTCGTTGTCGCTTCTCTCCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTG
  3   1   2       ext Lun1 5g3  in                         CABD2830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTC
  3   1   2       ext Ovi1      in                        CABI10914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  3   1   2       ext Ski1 5g3  in                         CABJ3988.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAAC
  5  -1   2       ext Lun1      in                        CABD14459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCATACACCACTGGCCAGCAGTTTGTGTACAGTGGCTGTTCCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACATTAAAA
  3   1   3        nb Neu       in                    TNeu110l04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACAGGTCGAGTTGTAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAACCTTTTCTCAAACAAAAAAAAAAAAAAAA
  3   1   3        nb Lun1      in                        CABD10325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTTCTCTTTCTCAGTTTATGATTTGTTAACGGGTCAGATAGTGAAGAAACTGACAAATCACAAAGCATGCGTGAGAGATGTTAGCTGGCATCCATGTGAGAACAAGCTTGTCAGCAGCTCTTGGGACGGAAACCTCCGTGTCTGGGAACATCGCCAGGCTGAGTTTTACCCAGAAGATCTGCGTACCCCGCCATTGGAATCTTGCTGATAGCTTATACTCGTGGTAGCCCACAATACTAGCTACACAAGTGTGTCATGACAGTGATGTATTTGTGTGCACTAGAAGAGAGAGGACTGGATACAGTGTGTAGGGAAAAAAATGTGAGGTGCTAAATATCTCTGTGTGAACAAATTTCTTATATATACACTCATAATTGAACCAAGGAAAGTAGTGGACACCATTTCAATTCTGCCTGTTTTGCCACAACATATGCAAATCTCAGAGTGCTAATTTCAGAATTCACTTTAAATATATGTTTAATTTTAGTGGAGAAGAATGTTAGATATGTACATTTTAAGACGTGCAATTACTTGGCATGACTTCTGTGCGGCATGTGTTTACATGCACTTTGTGTTTGTAAAACAGCATGGGGTGAATGACTGATAAAAAGATATTTTGATGTGCTAACAGATGAATGCAGGGCTGTTACATGTTAAGAAGAGGAAAGACATGGGGGATGTTAATAATTAGTGATATATAATATGGGGGCGGGGTTACTGTGTTTCTGATTGCTTATAGGCTTCTGTAATAAACCTTTCTCAAACAC

In case of problems mail me! (