Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 290.0    0Xt7.1-CABH6893.5                          158 PI      75        121      698                MGC131016 protein [Xenopus laevis]
     2 198.0    0Xt7.1-TTpA046i07.5                          2 PI      100        67      170                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012070759 Xt7.1-TGas119k09.3 - 168 ESTs
                                                                       ........-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas119k09.3                                                                                                                                                                                   GCAATAGAGATGAGACTGCGTGGCAAGAACGTCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222113                                                                                                                                                                                         GAGATGAGACTGCGTGGCAAGAACGTCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                        4     4     4     4     6     6     8     8    13    13    17    17    28    28    32    32    41    41    47    47    54    55    55    56    56    57    56    57    57    58    57    59    60    62    59    62    59    63    61    63    60    63    62    64    62    64    61    64    61    64    62    64    63    65    62    65    63    65    63    65    63    67    61    67    65    67    65    67    64    66    64    66    64    66    63    65    62    66    64    67    63    67    64    68    64    68    64    69    64    71    64    71    65    70    65    70    65    69    65    71    65    69    65    68    65    69    66    70    67    70    67    71    64    68    66    68    62    64    61    63    58    60    57    59    58    60    57    60    56    60    57    60    55    58    55    58    55    58    51    54    48    52    44    49    46    50    44    49    50    54    48    53    48    55    45    52    43    50    46    55    53    59    56    62    59    63    63    70    68    75    73    78    73    79    74    81    77    83    79    84    78    84    81    87    82    87    83    89    88    90    90    90    88    88    87    89    88    88    88    89    88    89    88    90    91    92    91    93    92    94    90    93    89    92    85    91    86    90    86    89    86    88    84    86    85    86    85    86    83    85    85    85    83    85    83    84    81    83    83    83    82    82    81    82    78    81    76    78    70    75    71    72    70    72    71    72    70    72    69    72    70    71    70    72    69    72    69    72    69    72    69    71    68    71    67    70    64    68    63    68    63    66    61    66    61    65    53    59    54    59    50    58     4    10     4     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------C----
                                               BLH ATG     121    1418                                                                                                                                                                                   
                                               BLH MIN     121     131                                                                                                                                                                                   
                                               BLH MPR      94     131                                                                                                                                                                                   
                                               BLH OVR     121      58                                                                                                                                                                                   
                                               CDS MIN     121      21                                                                                                                                                                                   
                                               EST CLI      86      21                                                                                                                                                                                   
                                               ORF LNG     121       2                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bb ---= 2e-017     BAE95627.1 GTP binding protein Rho [Branchiostoma belcheri] =================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Br ---- 2e-019     ABB85359.1 Ran [Branchiostoma belcheri tsingtaunese] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Sc ---- 6e-047     NP_010948.1 probably involved in intra-Golgi transport or in the formation of transportvesicles at the most distal Golgi compartment; Ypt31p [Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Ci ==== 3e-088     BAC57527.1 GTP-binding protein rab-2 homologue [Ciona intestinalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dm ==== 3e-099     NP_477090.1 Rab-protein 2 CG3269-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dr ==== 2e-100     NP_958862.1 RAB2, member RAS oncogene family [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Gg ==== 2e-100     NP_990559.1 GTP-binding protein [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Sp ==== 2e-101     XP_782537.1 PREDICTED: similar to RAB2, member RAS oncogene family [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Ce ==== 4e-103     NP_491233.1 RAB family RAB-2 (23.6 kD) (rab-2) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 9e-105     NP_766189.1 RAB2B protein [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Hs ==== 7e-106     NP_116235.2 hypothetical protein FLJ14824 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 6e-119     AAH71068.1 MGC78967 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === ?? ==== 6e-119     NP_001085321.1 MGC78967 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 8e-121     CAJ83496.1 RAB2B, member RAS oncogene family [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas119k09.3                                                                                                                                                                                       TAG---TGA---------------------------------TAG------TAA---------------------------TAA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------ATG------------------------------------------------------------------------------------TAA---------------ATG---ATG------------------------------------------TAG---------------------------------------------TAA---ATG------------------------------TAA---------------------------------------------TAA------------------------------------TAA---------------TAG------------------------------------TAA------------------------TAA------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------TAGATGTAAATG------------------------------------------------------------------------TGA---------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   1           Tbd0 FL                     IMAGE:5379004.FL-MGC                                                                                                                                                                                                                                   GTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas102k22.FL-Sanger                                                                                                                                                                                                                                                                               CTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g3  in                   TEgg073d22.p1kSP6 CCATATTGGTACAGTAATGCTGCTACTCATTCCTCCTATAGTATAACAATAGGATGTGAGGCAGCCATAGAGACTATTCATTAGAATGCTACACGTATCGAATACAAAAGAGCGAACATCCGGCTTAGTAAAGAACGTCGCTACAAGCCGTACACCAGATAGAGAGTCTTTTCCGGAAGCAATAGAGATGAGACTGCGTGGCAAGAACGTCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAG
  5   1   0       chi Hrt1                                 CAAQ8495.5p                                                                                   ATTTTTTAAAAAAAtgattttcttttcctctgtaataataaaatagtaccttgtacttaatcctattatatataattaatctttacgggaggccaaacaatcctattgggttcattaaatgtttaaattattttttagtaagcttaagctatggagatccaaattacggaaagaacacttgtctggaaaaccccagctcccaagcattctggataagaggtcccatacctgtattattattcACATAGAGTAATGCTCCAGATACAAATGATGGGTAAATGAGCACAATGGGTCACCTTTAGTGCTGCTGCACTTCCATCTGGGCATTAACAATTGACCCCTAAGATATCAACATTACTGATGTAATTTAAGTTTTCCTTAATTTTTGTTTTTTACTACACAGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGGTCAGAAAGGCTTTTTGTTTTTTCATTAATGGCTTCATGCCAATTATCAGACTCTTAATTTAGGCATTGTTTCTCCTTCTGTTTCAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGC
  5   1   2       bld Egg  5g3  in                   TEgg049p16.p1kSP6                                                                                                                                                   GCCGTTCACCAGATAGAGAGTCTTTTCCGGAAGCAATAGAGATGAGACTGCGTGGCAAGAACGTCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACT
  5   1   2       bld Egg  5g                        TEgg106b17.p1kSP6                                                                                                                                                                   CCCGGGTTTTCCGGAAGCAATAGAGATGAGACTGCGTGGCAAGAACGTCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAG
  5   1   2       bld Egg  5g                        TEgg106b18.p1kSP6                                                                                                                                                                   CCAGGGTTTTCCGGAAGCTAAACAGATGATACTGCTTGGCAAGAACTTCTCTCTGGGAGCTCTAGTTATAGTAATGCAGTTCTAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGCATATCGTTATTGGTGATACAGGTGTGGGAAGATCTTGTCTGCTTCTTCACTTTACACATAACAGGTATCAACCAGCTCATGATTTAACAATTAGCGTTCATGTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCATACTACATATATGGGACTCCGCTGGACAGGAGGCATTTCGTTCAATTACAAGATCTTATTAACGATGTGCTGCTGGGGCGCTGCATAGGTATGATATAACTGGAAGGGAAAACTTTAGCCACCTCACTT
  5   1   2       bld Neu  5g3  in                   TNeu115n18.p1cSP6                                                                                                                                                                                                     CGTGGCAAGAACGTCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTA
  5   1   2       bld Egg  5g                        TEgg118m09.p1kSP6                                                                                                                                                                                                       TGGCAAGAACGTCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATC
  5   1   2   12  bld Gas7 5g3  in                         XZG54751.5p ................................................................................................................................................................................................................GTCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAAGCAACAGAATTATTACACTAGAGGAATTCATAAAACCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGGTCTATATCAGACTTTCCTTTCT
  5   1   2       bld Gas  5g                        TGas011n16.p1kSP6                                                                                                                                                                                                                  TCTCTCTGGGAGCTCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAAGCCTTCATTGACACTG
  5   1   2       bld Gas8 5g3  in                          st96i11.5p                                                                                                                                                                                                                           GGGCTCGAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAA
  5   1   2       bld Tbd0 FL   in                    IMAGE:5379004.y1                                                                                                                                                                                                                            TCGGGATGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGA
  5   1   2       bld Egg  5g                        TEgg130i08.p1kSP6                                                                                                                                                                                                                              CCGGGGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAA
  5   1   2   10  bld Liv1 5g3  in                         CAAR2484.5p ..............................................................................................................................................................................................................................TCTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACA
  5   1   2   10  bld Te1  5g3  in                         CBWN6917.b1 ...............................................................................................................................................................................................................................CTAGTTAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCAC
  5   1   2   10  bld Ova1 5g3  in                         CABE6200.5p ....................................................................................................................................................................................................................................TAGAGTAAGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTT
  5   1   2       bld Gas8 5g3  in                          st95i11.5p                                                                                                                                                                                                                                            AGGCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGA
  5   1   2   12  bld Tad5 5g3  in                         XZT21318.5p .............................................................................................................................................................................................................................................GCAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGNTCTATATCAGACTTTCCTTTCTTTCTGT
  5   1   2       bld Egg  5g3  in                   TEgg033k21.p1kSP6                                                                                                                                                                                                                                               CAGTTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATC
  5   1   2       bld Neu  5g                        TNeu141k05.p1cSP6                                                                                                                                                                                                                                                  TTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCACAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCC
  5   1   2       bld Gas  5g                        TGas011e05.p1kSP6                                                                                                                                                                                                                                                  TTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAAGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCANCANGGACTGTTTGACGTGAATAATGAAGCTAATGGAATC
  5   1   2       bld Te5       in                         CAAO4890.5p                                                                                                                                                                                                                                                  TTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCANACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCCTGTCTATATCAGAC
  5   1   2   14  bld Te5  5g3  in                         CAAO9788.5p .................................................................................................................................................................................................................................................TTCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATC
  5   1   2   10  bld Ova1 5g3  in                         CABE1215.5p ..................................................................................................................................................................................................................................................TCAAAGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCC
  5   1   2       bld Gas  5g3  in                   TGas115i14.p1kSP6                                                                                                                                                                                                                                                       AGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGG
  5   1   2   14  bld Brn4 5g3  in                         CAAL8343.5p ......................................................................................................................................................................................................................................................AGGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATAT
  5   1   2       bld Neu  5g                        TNeu100m20.p1cSP6                                                                                                                                                                                                                                                        CCCGGGCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAG
  5   1   2   12  bld Gas7 5g3  in                         XZG30811.5p .......................................................................................................................................................................................................................................................GGAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCCTGTCTATATC
  5   1   2       bld Gas  5g3  in                   TGas062o05.p1cSP6                                                                                                                                                                                                                                                         GAAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTTGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATC
  5   1   2   10  bld Ova1 5g3  in                         CABE6374.5p .........................................................................................................................................................................................................................................................AAGCCTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCC
  5   1   2   12  bld Tad5 5g3  in                         XZT31195.5p .............................................................................................................................................................................................................................................................CTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCT
  5   1   2   10  bld Tbd1 5g3  in                         CBXT4143.b1 .............................................................................................................................................................................................................................................................CTCCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCT
  5   1   2   14  bld Brn4 5g3  in                        CAAL10075.5p ................................................................................................................................................................................................................................................................CTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCANACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCCGCATACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCCTTC
  5   1   2       bld HeRe 5g3  in                     EC2CAA17DA05.g1                                                                                                                                                                                                                                                                      GGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGACATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGC
  5   1   2       bld Egg  5g                        TEgg098d13.p1kSP6                                                                                                                                                                                                                                                                        TAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATG
  5   1   2       bld Egg  5g3  in                   TEgg071b17.p1kSP6                                                                                                                                                                                                                                                                         AATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGA
  5   1   2       bld Egg  5g3  in                   TEgg071b18.p1kSP6                                                                                                                                                                                                                                                                         AATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATG
  5   1   2   32  bld Gas7 5x3                              XZG9362.5p ........................................................................................................................................................................................................................................................................TATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCANACAGAATTACTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATC
  5   1   2       bld TpA  5x3  out                  TTpA063i20.p1kSP6                                                                                                                                                                                                                                                                            CACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAAACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAG
  5   1   2   12  bld Gas7 5g3  in                         XZG65643.5p ..............................................................................................................................................................................................................................................................................CTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTNTTTATCACTCCCTGTTCTGCCTGTTCTATATCAGACTTTTCCTTCTTTCCTGTCTCCCGCATTACATAAAATATAA
  5   1   2       bld Gas  FL   in                   TGas102k22.p1cSP6                                                                                                                                                                                                                                                                                TGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCGGGCGTGCAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTATGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTGATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACT
  5   1   2   12  bld Gas7 5g3  in                         XZG15681.5p ................................................................................................................................................................................................................................................................................GCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGACGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCT
  5   1   2       bld HdA  5g3  in                   THdA053j17.p1kSP6                                                                                                                                                                                                                                                                                  CCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATAT
  5   1   2   12  bld Gas7 5g3  in                         XZG64969.5p ......................................................................................................................................................................................................................................................................................GTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTTCCTTCTTTCCT
  5   1   2       bld AbdN 5g3  in                       IMAGE:7007130                                                                                                                                                                                                                                                                                           CTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGGAATCTGTATATAATGCTCATGGGCCTTTCTTTATATATAC
  5   1   2       bld TbA  5g3  in                   TTbA005m05.p1kSP6                                                                                                                                                                                                                                                                                           CTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTC
  5   1   2   10  bld Te1  5g3  in                         CBWN4768.b1 ............................................................................................................................................................................................................................................................................................CTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGG
  5   1   2   32  bld Tad5 5g                              XZT54796.5p .............................................................................................................................................................................................................................................................................................TGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACA
  5   1   2   10  bld Tbd1 5g3  in                         CBXT5176.b1 ..............................................................................................................................................................................................................................................................................................GACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCAC
  5   1   2       bld Gas  5g3  in                   TGas062h09.p1cSP6                                                                                                                                                                                                                                                                                                 ACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTTTGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTT
  5   1   2       bld Te5       in                         CAAO2973.5p                                                                                                                                                                                                                                                                                                 CGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTC
  5   1   2       bld Te5       in                         CAAO8670.5p                                                                                                                                                                                                                                                                                                 CGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGGCTTTCT
  5   1   2   32  bld Gas7 5x3  out                        XZG41158.5p ................................................................................................................................................................................................................................................................................................CGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGT
  5   1   2   10  bld Tbd1 5g3  in                         CBXT9729.b1 ................................................................................................................................................................................................................................................................................................CGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCA
  5   1   2   10  bld Eye  5g3  in                         CCAX1068.b1 ................................................................................................................................................................................................................................................................................................CGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGT
  5   1   2       bld Egg  5g                        TEgg121o11.p1kSP6                                                                                                                                                                                                                                                                                                  GATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGATCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAACAGGCCTTCATTGACACTGCCAAAGAAATTTACGAAAAGATCCATCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTA
  5   1   2       bld Egg  5g3  in                   TEgg003c15.p1kSP6                                                                                                                                                                                                                                                                                                        CCGGGGGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATG
  5   1   2       bld Ovi1      in                        CABI10600.5p                                                                                                                                                                                                                                                                                                                CGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAANGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTTCTCTTTATTCCATCTGTGTATTTAAGCCTAAAAATGGAAC
  5   1   2       bld Spl2      in                        CBSS5614.fwd                                                                                                                                                                                                                                                                                                                                CAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATC
  5   1   2       bld Egg0                                 dad68b09.y1                                                                                                                                                                                                                                                                                                                                                 GTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGA
  5   1   2       chi Gas7      in                          XZG5757.5p                                                                                                                                                                                                                                                                                                                                                                     CCCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTTCAATATG
  5   1   2       bld Gas       in                   TGas087p08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                          TCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAG
  5   1   2       bld Neu       in                   TNeu069n18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                          TCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTA
  5   1   2       bld Neu                            TNeu001o23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                          TCTGCTTCTTCAGTTTACAGATAAGAGGTTGGGGGCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGGGGGGGTGTGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGGCATAATACTGATTGGAAATAAAAGGCGCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACT
  5   1   2       bld Gas7      in                         XZG44147.5p                                                                                                                                                                                                                                                                                                                                                                                                       CCCACGCGTCCGATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTTAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACAT
  5   1   2       bld Te5       in                         CAAO3649.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGA
  5   1   2       chi Egg                            TEgg108n15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATCATTATTGGTGATACAGGTGTGGGAAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGATTTAACAATTGGTGTTGAGTTTGGCGCACGCATGATAAATATTGATGGAAAACCTATCAAACTACAGATATGGGACACGGCTGGACAGGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCGCTGCTAGTGTATGATATAACAAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTT
  5   1   2       bld TpA       in                  TTpA018i18.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGGGCGCTGCTAGTGTATGATATAACAAGAAGGGAAACCTTTAGCCACCTCACTTCGTGGCTAGAAGATGCTCGCCAACATTCAAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCNATGTGTAA
  5   1   2       bld Neu                            TNeu009h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAATTCAAATATGGTCATAATACTGTTGGAATAAAATGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAAACTTTCCTTCTTTCCTGTCTGCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTGACCTTTTCTTCTTTATTGCAATCTGTGTGTTTAAAGCCTAAAAAATGGAACAAAAGGAATATGCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACA
  5   1   2       bld Tad5      in                         XZT35937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATAATACTGATTGGAAATAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCATGAAAATTGTTACATTTTCTCTTATTTAAA
  5   1   2       bld Gas7                                 XZG46026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAAGTGATCTTGAATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAAT
  5   1   2       bld HdA       in                  THdA013j02.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCTCGTAGGGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTG
  5   1   2       bld Gas7      in                         XZG20732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAAATGTTACATTTTCTCTTATTTAAAATGTTGTTAATTCTGTATCTAA
  5   1   2       bld Egg       in                   TEgg039b13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGGGGAAGCTTTTGCTCGGGAAATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAAGTGTTGAGT
  5   1   2       bld Brn4      in                         CAAL6081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTNCATGAAAATTGTTACATTTTCTCTTATTTTAAATGTTGTAAATCTGTATCTAACATGGGTAC
  5   1   2       bld Ovi1      in                         CABI8387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATC
  3   1   2       bld Gas                             TGas139a19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAAAACTGCAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1      in                        CABI10600.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCCAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCAC
  5   1   2       bld TbA       ?                    TTbA056d10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGAATCCCCGGGCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTG
  5   1   2       bld Gas                            TGas021i22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTACAAAAANATCCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATNCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTT
  5   1   2       bld Gas7      in                         XZG13458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCAGCAGGGACTGTTTGACGTGAATAATGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCCAGCAGCATTGCAACTC
  5   1   2       bld Neu                            TNeu008n09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCTTTGGAAAGCTAATGGAATCAAATTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTTAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTA
  5   1   2       bld Tbd1      in                         CBXT1116.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGAAGCTAATGGAATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGT
  5   1   2       bld Tad5                                 XZT15613.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGTTGGACCCCAGCAATCAATAAATGAGCCGCTTGGAAGTGGACTACGACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTT
  5   1   2       bld Neu                            TNeu027i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGACTACGACAAAACCAAAATGAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCANGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGC
  3   1   2       bld Brn4 5g3  in                        CAAL10075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTT
  5   1   2       bld Brn4      ?                         CAAL19297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAACCAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTA
  5   1   2       bld Gas7      in                         XZG29392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAATGAAGGTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTG
  3   1   2       bld Tbd1 5g3  in                         CBXT4143.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGAGGAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAAAAAAAAAAAAAAA
  5   1   2       bld Gas       out                  TGas102g21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTTCTGGATGCTGCTGAAGCAAACAAAATCATTACACTAGAGGAATTTCATAAACCCAGCTTCATGCACTCCACATCTTTTTATCACTCCTGTGACTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTTCGCATTACATAAAATATAATGGAATCTGTGTATAATGCTCATGGCCTTTCTTTATAGGTGTGAGTGAGGTCTTTTCTAAATTCTACATAGGTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTCGTGCTCTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTTAAGCGTAAACCCACATCCCAATGCGGGCAATTATATATCATGTGTA
  3   1   2       bld Tbd1      in                         CBXT1116.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAACTTCTGGATGCTGCTGAAGCAAACAGAATTATTACACTAGAGGAATTCATAAACCCAGCTTCATGCACGCCACATCTTTTTATCACTCCTGTTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas119k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCTGCCTGTTCTATATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAATAAATACTGATCACA
  3   1   2       bld Gas  5g3  in                    TGas115i14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATaaaaaaaaaagaataaaagaaagagaaaaaatattaaaaaaaaaaaaagaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2      seed Gas       in                    TGas119k09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT64949.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGACTTTCCTTCTTTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTA
  3   1   2       bld AbdN 5g3  in                       IMAGE:7007130                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTTCTTTCCTGTCTCCCGCATTACATAAAATATAAGGGATTCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTGCCAC
  3  -1   2       bld Ski1      in                        CABJ10841.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCATATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGT
  5  -1   2       bld Ski1      in                        CABJ10841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCTGTCTCCGCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCATATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGT
  3   1   2       bld Egg       in                    TEgg039b13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCCATGTTAATAAAGTTTTCCTGTATTATAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg049p16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTTTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg073d22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAAGAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas062h09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu069n18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       ?                     TNeu091b23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATACATATTTGGTTTTTTTCAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCGGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGAGGTATAAGTAATCTTATGCTTTGGCCTCCATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTCCCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTTAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu115n18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATTACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATACATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas062o05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCNCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas087p08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATAAAATATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGGGCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA018i18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAAGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGGTTTTTTNTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTTTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Tbd0                               IMAGE:6977841                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTCTTTTCGCATCATAAATAGGGAATTGATTAAGGTCAGGCCTTCTTATAAATAATGGTTTTTTAAGTTAACATATTTTTCCCTTTTCTATTGTTCCAATTGCTGATTTAAAGCGTAAAAAATGGACAAAAGGAATATCCGTGTGCTTTGATATAAAGTACATAAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTGCCA
  3   1   2       bld Tbd1 5g3  in                         CBXT5176.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGGAATCTGTATATAATGCTCATGGCCTTTCTTTATATATATATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAAAA
  3   1   2       bld Ovi1      in                         CABI8387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTATATATGCTCATGGGCCTTTCTTTATATATATATTTGTTTTTTTNTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCNGTATTATAAGAAAAAAAGCCTCTCGCC
  3   1   2       bld Te5       in                         CAAO8670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTNTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Liv1 5g3  in                         CAAR2484.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Ova1 5g3  in                         CABE6374.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTTGTTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Tad5                                 XZT41985.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTTGGTTTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Tad5      in                         XZT35937.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATTGGGTTTTTNTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTAT
  3   1   2       bld Tad5      in                         XZT64949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTTGGTTTTTTTTAGTTTTACATAGTTCTTCACCCTTTTCTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTAT
  3   1   2       bld Te5       in                         CAAO3649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTNAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAAGG
  3   1   2       bld Ova1 5g3  in                         CABE6200.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTANAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Egg  5g3  in                    TEgg071b17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAAAGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTTTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCCCCTGCCATGTTAATAAAGTTTTCCTGTATTATTGGGAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg071b18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTAAGTTTTACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAAAGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTTTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCCCCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGGAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA17DA05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTG
  3   1   2       bld Brn4      in                         CAAL6081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACATAGTTCTTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  5  -1   2       chi Lun1      in                         CABD6357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATCTGTAAACTGAAGAAGCAGACAAGATTTTCCCACACCTGTATCACCAATAATGATATACTTGAAGAGGTAGGCATACGACATGATGGCAATCGTCAGAGCCACCAAGGCAGCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCGTGTATTA
  3   1   2       bld HdA       in                    THdA013j02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCACCTTTTCTTCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTNAAGAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas7 5g3  in                         XZG30811.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACCTTTTCTTCTTTATTCCAATTCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTAT
  3   1   2       bld Te5       in                         CAAO2973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATT
  3   1   2       bld Te5       in                         CAAO4890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTNTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTAT
  3   1   2       bld Gas7      in                         XZG44147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCTTTATTCCAATCTGTGTATTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5 5g3  in                         XZT21318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTNATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Gas7 5g3  in                         XZG64969.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATTCCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTAT
  3   1   2       bld Gas8 5g3  in                          st95i11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATTCCNATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATGGAAGTTATGTATTAACTGTCTGGTG
  3   1   2       bld Lun1      in                         CABD6357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGCAATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTAT
  3   1   2       bld Brn4 5g3  in                         CAAL8343.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCTGTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  5   1   2       bld Egg       in                   TEgg030o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTGTGTATTTAAAGCCTAAAAAATGTAGTGTCCATATTAATGTACTTTATATCAAAGCACAAGGATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAGACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGACAATTGTTACATTTTCTCTTATTTTAAGGTGTTGGTGGTTCTGTATCTAACATGGGTACCAATAGTCTGTATCCTCTGCGTGCCAGTGGAAATCCCCAATGTCTGGAAATGCAGGGCATT
  3   1   2       bld Gas8 5g3  in                          st96i11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTATTTAAAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTNTAAGTTAAAGTTGGNTAGTGACATTTGTTNGTTACTTGCTCTGCAGGGNAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTG
  3   1   2       bld Egg       in                    TEgg030o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTATTTAAAGCCTAAAAAATGTAGTGTCCATATTAATGTACTTTATATCAAAGCACCAAGGATATGGACACTACATTTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS5614.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTATTTAAAGCCTAAAAAATGGAACAAAAGAAATATCCTTGTGCTNTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Te1  5g3  in                         CBWN4768.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAGCCTAAAAAATGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAA
  3  -1   2       bld Gas8      in                          st11k12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCT
  3   1   2       bld Gas7 5g3  in                         XZG65643.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCTAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCNCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  5  -1   2       bld Gas8      in                          st11k12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAAAAATGGAACAAAAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACAT
  3   1   2       bld Te5  5g3  in                         CAAO9788.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGACAAAAGGGAATATCCTTGTGCTNTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTCCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Ova1 5g3  in                         CABE1215.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Gas7      in                         XZG20732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAATATCCTTGTGCTTTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTAT
  3   1   2       bld Neu                             TNeu079a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAATATCCTTGCGCTTTGCTATAAAGTGCACTCATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCGCAGTGCGGGTAATTATATATCATGTGTATCAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCAGGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAACGTCGTTACTTTTGTATCTAACATGGGTACAAATAGTTTGTATCCTTCGCGTGCCAGCGGAAATCAACAATGTTTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGAGGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAATATAAATACTGATCGCATTTCAGAGCTACCTTTCATTATTTATTGATCAGTTGTATTTAGCAACACAACATGGATTTTCTTCAGCATAAGTAGGTTGCCACTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTATAGTTAAAGTAGGTTAGCGACATTTTTTTGTTACTTGCTCTGCAGGGAAAGGATTACGAAGTATATTGGATGTTATGTATT
  3   1   2       bld Te1  5g3  in                         CBWN6917.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTNTGATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAA
  3   1   2       bld Gas  FL   in                    TGas102k22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATATAAAGTACATTAATATGGACACTACATTTCAAATATGAGTGTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCCTGCCATGTTAATANAAGTTTTCCTGTATTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                          XZG5757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTAATATGGACACTACATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCAC
  3   1   2       bld Gas7 5g3  in                         XZG15681.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATGGGCGCTCCATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCCTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACCTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTAT
  3   1   2       bld TbA  5g3  in                    TTbA005m05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATTTCAAATATGAGTTTGAAGCGTAAACCCACCATCCNCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTTTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTNAAGAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG29392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGG
  3   1   2       bld Gas7 5g3  in                         XZG54751.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Tbd1 5g3  in                         CBXT9729.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTCAAATATGAGTTTGAAGCGTAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTTTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCCCCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  in                         CCAX1068.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGTTTGAAGCGGTAAACCCACATCCCAGTGCGGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATTTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTTTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTTTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCCCCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  3   1   2       bld Tad5 5g3  in                         XZT31195.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAACCCACATCCCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  5  -1   2       bld Gas8      in                          st11j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNAACCCACATCCCAGTGCGGGTACTTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGNTGGNTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAANTG
  3   1   2       bld Egg  5g3  in                    TEgg003c15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGTGCGGGTAATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg033k21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTATATATCATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCGAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGGATTATGAANGTATATTGGAAGTTATGTATTAACTNNGTCTNGGTTGCCCACCTGCCCATGTTAATAAAGTTTTCCCTGTATTATAATGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  in                    THdA053j17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGTGTAACAGTTAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACATGCCATGTTAATAAAGTTTTCCTGTATTATAAGAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd0 FL   in                    IMAGE:5379004.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGGTGTTGAGTAGAGGTTGTTGGTTTATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGATGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATGAAAAAAAAAAAAAAAAAAAAAG
  3  -1   2       bld Egg       in                    TEgg077j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ttttttttttttttttttttttttttttttctctgtnttntttttttAACGATTAGGAAACTGTTTTATCCACTTAAGGGGCATGTTGGCGTCCTTTCAATGAAAATTGTTACATTTTCCCTTATTTTAAAAAGGTGGTAATTCTGTAACCAACATGGGAACAAATAGTTTGTATCCTTTGCGTGCCAATGAAAATCAACAATGTCTGGAAATGCCGGGCATTGTCATATCATTTCCTATTCAGAAGTATAAGTAATCCTATGCTTTGGCCTTTATTGATGTAAAAGAAGGATCTCCCAACAAGCATTGCCACTCAAATAAATACCGATCCCATTTCAAAACTCCCATGCCTTATTTATTGAACAATTGGATTTAACAACAAAACCTGGATTTTCTTCCACAAAACAAGGTTAAAATTTGGGTGAAATAAAAACCCGGCCGCTTGAAAAAATCCTTTTAGGCCAAGTTATTTTAAGTTAAAGTTGGGTAGGGACATTTGTTTGTTACTTGCTCCGGAAAAAAAGGATTATGAAATATCTTGGAAGGTGTGTATAAACTGCCTGGCTGCCACCCGCCATGTTAAAAAAGTTTTCCTGTATT
  3   1   2       bld Gas0      out                        dad23d01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTTGTTTTTATTTTCCTTTTTAAGGAGCAGTAAACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTTTTCAGCAAAAATAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGGCTGGTTGCCACCTGCCATGTTAATAAAGTTTT
  5  -1   2       bld Egg       in                   TEgg077j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCAGTAACCTGTTTATCGCCTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACACGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTCGTATTTAGCAACAAACCATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGACGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCCCCTGCCATGTTAATAAAGTTTTCCTGTATTAAAAAAAATACAAAAAAAGCGGC
  3  -1   2       bld Gas8      in                          st11j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGTTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCT
  5   1   2       bld Gas                            TGas051j01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTATCGACTTAAGGGGCATGTTGTTGTCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTTTT
  3   1   2       bld Gas7      in                         XZG13458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAAGGGGCATGTGGTTGCCCTTTCAATGAAAAAAGTAACATTTTCTCGTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTGGTATCCTTTGCGTGCCAGTGGAAATCAACAAGGTCTGGAAATGCAGGGCATGGTCATATCATTTCCTATTCAGACGTATAAGTAATCTTATGCTTTGGCCCATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATGCG
  5   1   2       bld Egg                            TEgg095c14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCTTTCAATGAAAATTGTTACATTTTCTCTTATTTTAAAATGTTGTTAATTCTGTATCTAACATGGGTACAAATAGTTTGTATCCTTTGCGTGCCAGTGGAAATCAACAATGTCTGGAAATGCAGGGCATTGTCATATCATTTCCTATTCAGATGTATAAGTAATCTTATGCTTTGGCCTATATAGATGTAAATGAAGGATCTCCCAGCAAGCATTGCAACTCAAATAAATACTGATCACATTTCAGAGCTACCTTGCATTATTTATTGATCAGTTGTATTTAGCAACAAAACATGGATTTTCTTCAGCAAAACTAGGTTAACATTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAATCATTTTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGAGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTATTATAATG
  5   1   2       bld Neu                            TNeu132n13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGGTTGTATTAAATACCTGTCTGCTTGAGAAAAAATTCTAGGTCAAGTTATTTTAAGTTAAAGTTGGTTAGTGACATTTGTTTGTTACTTGCTCTGCAGGGAAAGGATTATGAAGTATATTGGAAGTTATGTATTAACTGTCTGGTTGCCACCTGCCATGTTAATAAAGTTTTCCTGTGTTATAATGAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)