Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012070783 Xt7.1-XZG7847.5 - 118 ESTs
                                                                       .........-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-XZG7847.5                                                                                                                                                                                                                                                                                                                      AGAGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAATCACTGTGTTTACTAAGCAATTTGGGCTTAAAAAATGATCTTGCAAACCATGAAAGTTCCTTTCACTGTTTCCACATTTAATGATGTCCTGTTAAGGGATGTTGAACC
                                                  Xt7.1-CHK-1008222803                                                                                                                                                                                                                                                                                                                            CGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAxxAxxxTGTTTACTAAGCAATTTGGGCTTAAAAAATGATCTTGCAAACCATGAAAGTTCCTTTCACTGTTTCCACATTTAATGATGTCCTGTTAAGGGATGTTGAACCCCAGTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                           7    11    13    17    27    33    36    43    43    49    48    55    53    60    64    69    75    80    91    94    90    94    90    94    93    95    92    95    93    95    92    95    93    97    95   100    94   100    93   100    94   102    95   101    94   101    92   102    96   103    97   105    96   105    95   106   102   109   102   109    98   109   100   108   106   109   104   111   106   111   105   110   108   112   105   111   107   111   107   111   107   111   105   109   104   109    99   109   101   106   102   107    99   106   100   107    98   107    99   106    99   106    98   105    98   104    98   103    98   103    93    97    91    96    91    95    87    95    89    95    84    95    82    92    81    91    73    91    67    90    68    84    61    76     9    17     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------C-T
                                               BLH ATG      98     906                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN      98     100                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR      98      72                                                                                                                                                                                                                                                                                                                      
                                               CDS MIN      98      30                                                                                                                                                                                                                                                                                                                      
                                               EST CLI      14      30                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG      98       2                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                            PROTEIN --- Bf ---- 3e-008     AAM18885.1 unknown [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Br ---- 4e-009     AAL74417.1 proteosome PSMB5/8 protein [Branchiostoma lanceolatum] =====================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN -== Ce ==== 7e-037     NP_491261.1 proteasome Beta Subunit (22.8 kD) (pbs-4) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Sc ==== 4e-046     NP_010928.1 Required for mitotic division and sporulation; Pre1p [Saccharomyces cerevisiae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 2e-062     NP_609804.1 CG17331-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Sp ==== 6e-078     XP_001178807.1 PREDICTED: similar to Proteasome (prosome, macropain) subunit, beta type, 2 [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 3e-090     NP_036100.2 proteasome (prosome, macropain) subunit, beta type 2; proteasome (prosome,macropain) subunit, beta type, 2; DNA segment, Chr 4, Wayne State University 33,expressed [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 4e-091     NP_002785.1 proteasome beta 2 subunit; proteasome subunit, beta type, 2; macropain subunitC7-I; multicatalytic endopeptidase complex subunit C7-1; proteasome componentC7-I [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 3e-095     XP_417777.2 PREDICTED: similar to MGC84496 protein [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 9e-096     NP_001002609.1 zgc:92282 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 4e-108     AAH72908.1 MGC80364 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 4e-108     NP_001085540.1 MGC80364 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xt ==== 2e-111     AAH84185.1 Hypothetical LOC496467 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-XZG7847.5                                                                                                                                                                                                                                                                                                                                                                                 TAG------------------------------------ATG------------------------------------------------------------------------------ATG------------------ATG------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TAA---TAA---------------------------------------------------------------------------------------------------TGA------------TGA---------------------------ATGATG------TAA---ATG---------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   1           Tad0 FL                     IMAGE:6982644.FL-MGC                                                                                                                                                                                                                                                                                                                                             GTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas060k08.FL-Sanger                                                                                                                                                                                                                                                                                                                                                    TTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAA
  5   1   2       chi TpA  5g                        TTpA075o23.p1kSP6 GCAGGTAGAAGCACAGGATCAGAGTTACCTTCAGCAAAGGGCAGAGCGAGAGAAAACAATGTGATAAAGGGGGAGAAAGTCATCGATAAAGGAGAGTAACAGATGCAGGGGAAGGGGAGAGAGTAACTGGCAGTAGAAGACACCAGGGAGGAAGCCTACAGAAGAGAGTTCCAAGTCTAGAGAGAGTGACTGAGAGAGTAAGTGAGAGAGTGAGAGTAACAGCCATAGAAGGAGAGACTACCTGGCGGGTGTAAGTGGCCCTGGAAGGCAGAAGGTACCGCTGAGAAAGTAAGAGAAGAAGAAGAAGAAGAAAAAAAAAAAAAAAAAAGCGGGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTA
  5   1   2       chi 1030 5x                         IMAGE:7026569.5p                                                                                                                                                                                                                                                                      ATGTTACCGGCACCCATCATGTTACCGGCGATATCTGATGACGTTAGTAGAGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTTCATCTGCTGCTTGCTGGGTATGAATGACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACTAACCCTCAGTATTCTGGATCGGCTCTACAACCCGGACCTGAACAAAAGAGGACCCCGTTAAACCTACCTAAAGAAATGGGTTTTGCAAAACCTCCGAAAACCGCTTTTTATCCTTGAAGCCTGCCCTTTTCTTTTCAAAGGGGAAGGGTGCCTTTCGATAAAGGGGAGGGGGGATCCCCTGGGAACTGTGGGGAAACGAGAAATTTCTCGGGCCTTTCAGGGGCCTCTTTTATAACCCTTT
  3   1   2       bld Hrt1      out                        CAAQ9702.3p                                                                                                                                                                                                                                                                                               GCAGAGCTTATTTTCTTGAGTTGCTCGTGCAGCTCGACTGTACAGCTACTGGAACATGCCATGATTCTCCTGCAAAAATGCAGTGTAGTTTAAGAGTTTTTGAAATAAAGCGAGTTGTACTAGTGTGAATACATAGCTTTTGAGAATGTGCGATTTGCCACCTGACCCTTGCATGGGAGATTACTGCCCAATGTCATGTGTTTTGCAGTAATAACCAGAGTCTTCGGGTTGTCAACTACACTTCCACTTGAACAAGGCTGGAAATGATCTATGGCAAATGAGTACTACAAGTAGCAGGAATAAAAACACTAATATGCTATTGGACTTTGAGCTTGTTCACCCCTCACTTATCTTTCTTGGAACAAAAAGGATAAATATGTAAAGGCATTTTATTTCTTTTTTACAGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAA
  3   1   2       bld TbA  5x3  out                   TTbA035b06.q1kT7                                                                                                                                                                                                                                                                                                       GATGGCATTAGGCATGCTCTAAAGGGTAAAATATGGTATTAGTCAACATGAGCAAAATAAATAGAACTTAGATGCAAAAAAAAAAAAAAAAAAGCGGCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATTTTTGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTTTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTATTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAAATAAAGTACCCTGTGCGGTTGCCTGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld BrSp 5g3  in                     EC2BBA13CA08.g1                                                                                                                                                                                                                                                                                                          GGGGACGTTAGTAGAGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGATTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTT
  5   1   2       bld BrSp 5g3  in                     EC2BBA30CC02.g1                                                                                                                                                                                                                                                                                                          GGGGACGTTAGTAGAGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACCGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGATTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTG
  5   1   2   32  bld Gas7 5g                               XZG7847.5p ..........................................................................................................................................................................................................................................................................................................ATGACGTTAGTAGAGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCCAGGAAA
  5   1   2   14  bld Brn2 5g3  in                        CAAJ24052.5p ...........................................................................................................................................................................................................................................................................................................TGACGTTAGTAGAGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGGTAATTTGTACCACTGTATNGAACAAATAAATACCCTGTGCATTTGCAT
  3   1   2       bld Tad5      out                        XZT65343.3p                                                                                                                                                                                                                                                                                                              TTGAGTTGCTCGTGCAGCTCGACTGTACAGCTACTGGAACATGCCATGATTCTCCTGCAAAAATGCAGTGTAGTTTAAGAGTTTTTGAAATAAAGCGAGTTGTACTAGTGTGAATACATAGCTTTTGAGAATGTGCGATTTGCCACCTGACCCTTGCATGGGAGATTACTGCCCAATGTCATGTGTTTTGCAGTAATAACCAGAGTCTTCGGGTTGTCAACTACACTTCCACTTGAACAAGGCTGGAAATGATCTATGGCAAATGAGTACTACAAGTAGCAGGAATAAAAACACTAATATGCTATTGGACTTTGAGCTTGTTCACCCCTCACTTATCTTTCTTGGAACAAAAAGGATAAATATGTAAAGGCATTTTATTTCTTTTTTACAGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCC
  5   1   2       chi 1030                            IMAGE:7091633.5p                                                                                                                                                                                                                                                                                                                  GAGTAGAGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCTACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCTGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGGGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACTGGCGAGTTTGTAGAGAAGGTTCCAAATAACGTGCAGTTGTACAAAATGAGGATCGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCTGTCTGCTGCTTGCTGGGTATGATGAATATGACGGATCCTCGTAGTATTCATGGATTAACTTACATCTCTAGTTAAATTTAATTTGTTGAACTTGGCTACCGGGATTTTCTAAACCTCAGTTTCTGGATCCTTACTTTAAACATTACTGATATAATTTATTCATTAATCACTTCTATATGATTAGTAAACCTCTAAATGTTTATTTTTGAGTTGCCTTTATCTCATGAGGTATTATTTCTTTGAATTG
  5   1   2       chi 1030 5x                         IMAGE:7026656.5p                                                                                                                                                                                                                                                                                                                      GGAGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTTACCTAGCCGCTCTAGGCAAAAACGCGTTTTGCTGCACATGGCTACCGGGCTTTACCTAACCCTTCAGTATTCTGGGATTCCTACTTCCAACCCGGACTTGAAAAGGAGGGGACGCAGAAAAACTTCTAAAAGAAAATGTATATGCATAATCTTCCCGAGAGCCGCTTTTATACCTGAAACCCTGGCCTTCCTTTTAAAAGTTGGGGGGGTCCCTCCTATTAAGGAGTGGGGGACCCAATGGACTTTGGGAAACAAATTTCCTGCCTTTAGGGGCCCTTTTAACCCTTTCCCCTCTTCCCTTGGAATCAGCCCCCCCCCCCCTTTTTCCGTTTTTTAAAGAAAAAAAAGGGGTAACATTTTTCCACCACTCGTGATTTCTAATAACACAATAAAATTTAGCCCCCGTGGGGGAGTATTTCCGCTTGGTAGGGGACCTACCCCCAAGGATGAAAATATAAAAATAATAATAAGGAGACCCCCCCACGAGGTTCTCCAAAAGGGGGGACTGCCCCCTCCTGTCGGTGTGAGAGAAAATATTAGN
  5   1   2   12  bld Gas7 5g3  in                         XZG56252.5p .......................................................................................................................................................................................................................................................................................................................AGCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATCTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACT
  5   1   2   10  bld Limb 5g3  in                        CBSU3638.fwd ........................................................................................................................................................................................................................................................................................................................GCGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTCACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGCGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACTTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTT
  5   1   2       bld HeRe 5g                          EC2CAA43DE09.g1                                                                                                                                                                                                                                                                                                                          GGCGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTTCTTGGCAATGACTTCGTA
  5   1   2   32  bld Tad5 5g                              XZT61904.5p ...........................................................................................................................................................................................................................................................................................................................CGCCCATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACANATAAATTACCCTGTGCATTTGCATGTGGGACTCCCCA
  5   1   2       bld BrSp 5g3  in                     EC2BBA17DF09.g1                                                                                                                                                                                                                                                                                                                              GGGATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCT
  3   1   2       bld Tbd1 5x3  out                       CBXT18051.g1                                                                                                                                                                                                                                                                                                                                 ATTCCCGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCTAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGATTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  in                    EC0CBA002DH08.g1                                                                                                                                                                                                                                                                                                                                    GGGGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGATTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTA
  3   1   2       bld Gas  5x3  out                   TGas118m20.q1kT7                                                                                                                                                                                                                                                                                                                                      CGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTANCCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA  5g                        TTbA032p13.p1kSP6                                                                                                                                                                                                                                                                                                                                      CCCGGGGGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACT
  5   1   2   12  bld Tad5 5g3  in                         XZT24857.5p .....................................................................................................................................................................................................................................................................................................................................CGGCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCAAAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       chi Tad0 FL   in                       IMAGE:6982644                                                                                                                                                                                                                                                                                                                                       GGGATGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTACATGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGACGCAGGTGACACAGTCCAGTTTGCTGAGTACATTCAAACCAACTTGCATCTGTACAAAATGAGGAACGGCCATGAGTTGTCTCCTAGTGCCGCTGCAAACTTTACACGGTCACATGTGGCTGATTTTTTTCTCAGCAGGACCCCTTCGCCTGTCAATCTGCTGATGTGCCCGTTCTGTGCCCCATTACATAGCCTGCTTGTATCACCTGCACCCTCCTAGTCTCTTCCTGCCCAAGCAGTTCTTTGTCTGCATAAATCTTCTGGGTCTCCGCAATCCTATCCTCTCGTCTGTCATCAGTCGAATTTCTTACCTCATTTCGGGTATACACACTACACCAATGATTAACCTGTGGTACATCTCATTACTTGTTGGTTTGACTCTCTCTCTATATCACTAGTTCCACTAAACACAGCCATCTCTTTGGCTATCCTTGCTGCTTTTCCTTCTTCCCTTTCTTTCTCTTCTTCACTTTTATGAAGTTTTTGTTTCTTTCC
  5   1   2       bld Egg  5g                        TEgg131a19.p1kSP6                                                                                                                                                                                                                                                                                                                                        CCGGGGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTC
  5   1   2       bld Gas  5g                        TGas118k18.p1kSP6                                                                                                                                                                                                                                                                                                                                        GCCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGG
  5   1   2   10  bld Ova1 5g3  in                         CABE9500.5p .......................................................................................................................................................................................................................................................................................................................................CAATTCGGCACGAGGGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGANATAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG56252.3p                                                                                                                                                                                                                                                                                                                                        GCCTTGTGCTGATNTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATCTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAGG
  5   1   2       bld HeRe 5g3  in                     EC2CAA43AC09.g1                                                                                                                                                                                                                                                                                                                                         GCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAATGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTA
  5   1   2   10  bld Ova1 5g3  in                         CABE4047.5p ........................................................................................................................................................................................................................................................................................................................................CCTTGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCCTGGCTGACTATCCTTCCC
  3   1   2       bld Tad0 FL   in                       IMAGE:6982644                                                                                                                                                                                                                                                                                                                                            TGTGCTGATNTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTAGAAACAAATAAATTACCCTGTG
  5   1   2       bld 1030 5g                         IMAGE:7029431.5p                                                                                                                                                                                                                                                                                                                                            GGTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAGAAGGACCATAACTACTAAGAAATGTTACAAGCTCCGAACGCTTTATCTACTGCTCTCGAGCTCAAGGACTGTGATACTGN
  3   1   2       bld Ova1 5g3  in                         CABE4047.3p                                                                                                                                                                                                                                                                                                                                             GTGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  5   1   2       bld Neu  5g                        TNeu035l15.p1kSP6                                                                                                                                                                                                                                                                                                                                              CTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGAACTCATTAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTTCATNTTCTGGATCG
  5   1   2   10  bld Thy1 5g3  in                        CBST5341.fwd .............................................................................................................................................................................................................................................................................................................................................TGCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTG
  5   1   2   10  bld Te1  5g3  in                        CBWN15452.b1 ..............................................................................................................................................................................................................................................................................................................................................GCTGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTCACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGCGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACTTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCAAAAA
  3   1   2       bld Brn2 5g3  in                        CAAJ24052.3p                                                                                                                                                                                                                                                                                                                                                 TGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  5   1   2       chi 1030 5x                         IMAGE:7093445.5p                                                                                                                                                                                                                                                                                                                                                 GGATTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGAGCAGTAGAACTACTAAAGAATGTATAGCAGAGCCCAGAACGCTTATCTGAGCCGCCTTCTCCAGTGAGGTCTCATAAGATGATCATAGTCTAAGCGCGCACGCGTGAGCTGCGTGCACTGTATGACTAATGTACATAGATACTCCATCCATAGCTTTCTGTCATGGTGCACCCAGACACGCGTGATATGCCCGCGACTAAATGGCTAGAACTATGTGGACCAGATACTCA
  3   1   2       bld Gas  FL   in                    TGas060k08.q1kT7                                                                                                                                                                                                                                                                                                                                                  TTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACNTCGGGGAACCAACAGCNGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTTTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA30CC02.b1                                                                                                                                                                                                                                                                                                                                                    TTTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACCGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGATTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTAATATTTTTATATATTAAGGTTAATTTGTACCACTGTAAAAACAAATAAATTACCCTGGCA
  5   1   2       bld Tad5      in                          XZT3537.5p                                                                                                                                                                                                                                                                                                                                                    GATTGCTGTGTACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTC
  5   1   2       bld Gas  FL   in                   TGas060k08.p1cSP6                                                                                                                                                                                                                                                                                                                                                     TTGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGAC
  3   1   2       bld Tbd1 5g3  in                         CBXT2435.g1                                                                                                                                                                                                                                                                                                                                                     AACGCGTGGGACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA17DF09.b1                                                                                                                                                                                                                                                                                                                                                      TGCTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATAAACAAATAAATTACCCTGGC
  3   1   2       bld Ova1 5g3  in                         CABE9500.3p                                                                                                                                                                                                                                                                                                                                                        CTGTGTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAATAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCC
  5   1   2   10  bld Thy1 5g3  in                       CBST12485.fwd ...........................................................................................................................................................................................................................................................................................................................................................GTAACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGANACAAATAAATTACCCT
  3   1   2       bld Te1  5g3  in                        CBWN15452.g1                                                                                                                                                                                                                                                                                                                                                              AACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTCACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGCGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACTTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCAAAAAAAAAAAAAAA
  5   1   2   10 seed Tbd1 5g3  in                         CBXT2435.b1 .............................................................................................................................................................................................................................................................................................................................................................GACGTCCCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAAAAAAAAAAAAAGGGCG
  5   1   2       bld TpA  5g3  in                   TTpA059j24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                  TCCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCC
  5   1   2       chi 1030 5x                         IMAGE:7027996.5p                                                                                                                                                                                                                                                                                                                                                                   GCCGAGGCCGTAATTAGAGACTCATAACTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATTNCCTGCTNNGCTGTGTGTAGGAAGAGGGCAAGGGTGACACAGTCCAGTTTGCAGAGTACTTCAAAAGACGTGCANGTGTACAAAATGAGGAACGGCTATGAGTTGTCTTCTACTGCAGCCGCAAAACTTCAAAGGGAAAAAATCTGGGGGTGAAAAATTTTTTTGCAAAAAGGGGCCCCCCTTAAAAGGGGGGGAAAAAGTCGGGGTGTGGGGGGGGGAGAAAAAAAAAAAAAAAACCCCCCCCCCTTTTN
  3   1   2       bld Tbd1                                CBXT18339.g1                                                                                                                                                                                                                                                                                                                                                                    CCGAGGCCGTAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTTTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAA
  5   1   2   10  bld Liv1 5g3  in                         CAAR4545.5p ..........................................................................................................................................................................................................................................................................................................................................................................ATCGATTCGAATTGGCCGAGGCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu  5x                        TNeu128j14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                             CCCGGGGAGACTCATATCTCGGGTAACCAACAGCGGGGGGGGTGTGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTGAGAGGCGGGGGAGGGTCCATTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGGTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGAGTATCTTCGCAGCAGGAGCCCTTACCATGTCAATCTGCTGCTTGCTGGGTGTGATGAACA
  3   1   2       bld Ova1 5g3  in                        CABE10620.3p                                                                                                                                                                                                                                                                                                                                                                             TAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGAAAAAAAAAAA
  5   1   2       bld Ova1 5g3  in                        CABE10620.5p                                                                                                                                                                                                                                                                                                                                                                             TAATTAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGAAAAAAAAAAA
  5   1   2       bld Neu  5g                        TNeu095n22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                 TAGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTG
  3   1   2       bld Thy1 5g3  in                       CBST12485.rev                                                                                                                                                                                                                                                                                                                                                                                  AGAGACTCATAACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  5   1   2   10  bld Sto1 5g3  in                         CABG2545.5p ..................................................................................................................................................................................................................................................................................................................................................................................CTCGATTCAATTCGGCACGAGGAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGACAAAAAAAAAAAAAAAAAA
  5   1   2   30  bld Tbd1 5x3                            CBXT12357.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................AACTCGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAA
  3   1   2       bld Neu       ?                     TNeu108e11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                              CTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGCCTTCGTACTGGTGGCTGTGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCTCGATGTGGACACGATGTTTAAGATGAGCGAGAAGATCCTCCTGCTGTGCGTAGGAGAGGCAGGCGACACAGTCCAGTTTGCAGAGTACACTCAAAAGAACGTGCTGTTGTACAAAATGAGGAACGGCTATGAGTCGTCTCTCACTGCACCCGCAAAATTCTCACGGAGAAATCAGGGTGAATATCTTAGCAGCGGGACCCCTTACCATGTTCAATGTGTTGTTTGCAGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGTATTACCTAGCAGCTATAGCAAAAACGCGGTTTTCTGCACATGGCTACGGGGTTTCACCTAACCCTCAGTATTTTGGA
  5   1   2       bld Neu  5x3                       TNeu006n20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                              CTCGGGTAACCAACAGCGGCGGGGAATTGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATA
  5   1   2   32  bld Tad5 5g                              XZT21168.5p .............................................................................................................................................................................................................................................................................................................................................................................................CTCGGGTAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCA
  5   1   2       bld Neu                            TNeu108g11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                               TCGGGTAACCAACAGCGGCGGGAATATGGAGTCTGTGATTGGAATTCAGGGCAATGACTTCGAACTTGGGGCTGTGGACACAGGGTGGGCCTACAGCATCATTAAGATGAATCACTATGTGGACAACATGTTTAAGATGATCGATAAGATCCTGCTGCTGTGTGTATGAGATGCAGGTGACA
  3   1   2       bld Liv1 5g3  in                         CAAR4545.3p                                                                                                                                                                                                                                                                                                                                                                                                CGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  5   1   2   30  bld Tbd1 5x3                             CBXT7139.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................CGGGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCTAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGATTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAA
  5  -1   2       bld Mus1      in                         CABH4095.5p                                                                                                                                                                                                                                                                                                                                                                                                  GGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGG
  3   1   2       bld Thy1 5g3  in                        CBST5341.rev                                                                                                                                                                                                                                                                                                                                                                                                  GGGAACCAACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAG
  3  -1   2       bld Mus1      in                         CABH4095.3p                                                                                                                                                                                                                                                                                                                                                                                                   GGGAACCACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGG
  3   1   2       bld BrSp 5g3  in                     EC2BBA13CA08.b1                                                                                                                                                                                                                                                                                                                                                                                                         AACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGATTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATAAACAAATAAATTACC
  3   1   2       bld Sto1 5g3  in                         CABG2545.3p                                                                                                                                                                                                                                                                                                                                                                                                         AACAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAC
  5   1   2   10  bld Ski1 5g3  in                         CABJ3626.5p ........................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Mus1 5g3  in                         CABH6735.3p                                                                                                                                                                                                                                                                                                                                                                                                           CAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCC
  5   1   2   10  bld Mus1 5g3  in                         CABH6735.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................CAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Mus1 5g3  in                         CABH7828.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld 1030 5g                         IMAGE:7030208.5p                                                                                                                                                                                                                                                                                                                                                                                                           GAGCGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCANGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTTAATAATAAGGTTAAATTTGGACCACTGTTATGAAAACAAATAAATTTACCCTGTGCAATTTGCATGTTGGGAACTCCCCCGGACTATATTTATGTATAAACAAAAGATCGTAAAAAAGGGGTTCCCCTCTAGTTTCTAAAATTGGCCCCGCCCCCCTCCGGTAGT
  5   1   2       bld Neu  5x3                       TNeu016c02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                              CGGCGGGGAATTGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGC
  5   1   2       bld TpA  5g3  in                   TTpA053g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                              CGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGANACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCA
  3   1   2       bld TpA  5g3  in                    TTpA053g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                              CGGCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTTTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTAGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGANAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                          XZG6682.3p                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCGTCCGGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  3   1   2       bld Ski1 5g3  in                         CABJ3626.3p                                                                                                                                                                                                                                                                                                                                                                                                                GCGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  3   1   2       bld Mus1 5g3  in                         CABH7828.3p                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  3   1   2       bld Tad5 5g3  in                         XZT24857.3p                                                                                                                                                                                                                                                                                                                                                                                                                    GAATATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGAAAAAACAAATAAATTACCCTGTGCATTTGC
  3   1   2       bld HeRe 5g3  in                     EC2CAA43AC09.b1                                                                                                                                                                                                                                                                                                                                                                                                                       TATGGAGTATTTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAATGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGCGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTAGAAACAAATAA
  5   1   2       bld HdA  5x3  out                  THdA053j08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAGCGGCGATTACGCCACCATCAACGCCCCTTTCACACTGTCCCACATGCACACATCACTACTAACTCCCTCAGCCTTCTAGTGTCAGCATTCTAGTGACCAGACCAGCACCCCATCAGCATTTCAGACCTTGAACCAAATCACGTCTATTATACCTCCTGTCTTTCTTCAGTTGTAC
  5   1   2       bld 1030 5g                         IMAGE:7027419.5p                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTAAATATTAAGGGTTAATTTGTACCACCGGTATGAAACAAATAAATTACCCTGTGCATTTGCATGGGGGGACTCCCCGGGAAAAAAAAAAAAAAAAAGGATCCCCTTAGTTTCTAGAGACG
  3   1   2       bld Limb 5g3  in                        CBSU3638.rev                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTCACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGCGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACTTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCC
  3   1   2       bld Liv1      in                         CAAR6548.3p                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  5   1   2       bld Liv1      in                         CAAR6548.5p                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Mus1      in                         CABH3590.5p                                                                                                                                                                                                                                                                                                                                                                                                                          CCGAGGTCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAA
  5   1   2       bld Neu       in                   TNeu095b10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                           GAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTG
  3   1   2       bld Spl1      in                         CABK5206.3p                                                                                                                                                                                                                                                                                                                                                                                                                           GAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAA
  5   1   2       bld Spl1      in                         CABK5206.5p                                                                                                                                                                                                                                                                                                                                                                                                                           GAGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAA
  3   1   2       bld Neu       in                    TNeu095b10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                            AGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas037i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                            AGTATCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGA
  3   1   2       bld Mus1      in                         CABH3590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                TCTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAA
  5   1   2   12  bld Gas7 5g3  in                          XZG6682.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................CTGATTGGCATTCAGGGCAATGACTTCGTACTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas0      in                         dad23c08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGCAATGACTTAGTACCTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGAC
  5   1   2       bld Egg0      in                         dad63g03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCTTGTGGCTGCGGACACAGTGTGTGCCAACAGCATCATTAAGATGAAGCACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGTTTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTCTAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCAT
  3   1   2       bld Hrt1      in                        CAAQ12709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGACATTCACTGTGTTTACTAAGCAATTTGGGCTTAAAAAATGATCTTGCAAACCATGAAAGTTCCTTTCACTGTTTCCACATTTAATGATGTCCTGTTAAGGGATGTTGAACCCCAGTAAAGGGAGTAAAAGATAAAAAAAAAA
  5   1   2       bld Hrt1      in                        CAAQ12709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGATGTGGACAAGATGTTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGACATTCACTGTGTTTACTAAGCAATTTGGGCTTAAAAAATGATCTTGCAAACCATGAAAGTTCCTTTCACTGTTTCCACATTTAATGATGTCCTGTTAAGGGATGTTGAACCCCAGTAAAGGGAGTAAAAGATGAAAAAAAAAA
  5   1   2       bld BrSp      in                     EC2BBA30DD09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTTCACACAGAGAAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTTTTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGA
  3   1   2       bld BrSp      in                     EC2BBA30DD09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAAGATGAGCGAGAAGATCCTGCTGCTGTGTGTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTAAAATTATATATTAAGGTTAATTTGTACCACTGTATAAACAAATAAATTACCCTGTGCA
  3   1   2       bld Gas0                                 dad44c10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTAAGATGAGCGAGAAGATCCTGCTGCTGTGTGAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCTTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATATTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTATGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGAATGTGGGACTTCCCAGGAAAAAAA
  3   1   2       bld Egg0      in                         dad63g03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAGAAAAGGCAGGTGACACAGTCCAATTTTGCAGAGTACATTCAAAAGAAACGTGCAGTTGTGCAAAATGAGGAAGGGCTATAAGTTGTCTCCTACTGCAGCGGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAA
  3   1   2       bld Gas0      in                         dad23c08.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGGAGAGGCAGGTGACACAGTCCAGTTTGCAGAGTACATTCAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGGCCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTATGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGA
  3   1   2       bld Gas7      in                         XZG49414.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGAAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas7      in                         XZG49414.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAGAACGTGCAGTTGTACAAAATGAGGAACGGCTATGAGTTGTCTCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGAAAAAAAAAAAAAAAGG
  3   1   2       bld Neu5      in                         ANHP2036.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGGAGACAACTCATAGCCGTTCCTCTTTTTGTACAACTGCAGCCGCAAACTTCACAGGGAGAAATTTGGCTGACTTTTTTGGCAGCAGGACCCCTTACCATGTCAATTTGCTGCTTGCGGGGTATGATGAACATGACGGACCCTCGTTGTTTTCCATGGATTACCTAGCAGCTTTAGCAAAAACGCGTTTTGCTGCACATGGGTAGGGGGCTTACCTAACCCTCAGTTTTTTGGATCGTTTCTACAAACCAGCCCTGCCAAGGGGGGACGCGGTGGAACTTCTAAAGAAATGTTTAGCAGAGCTCCAGAAGCGCTTTTTCCTGAGCCTGCCTTCCTTCCCAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGAGGATTCCTGCTTCAGGCCTTTAACCTTACCTTTCCCTGACTCGCCTCCCCCTTTTTTCTTTTTATATATTAAGGTTAATTTGTACCCCTGTTTGAAACAAATAAATTACCCTGTGCATTTCCATGTGGGCCTCCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   2       bld Neu5      in                         ANHP2036.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGGAGACAACTCATAGCCGTTCCTCATTTTGTACAACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCC
  3   1   2       bld Te1       in                        CBWN17456.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGAAAAAAAAAAAAA
  5   1   2       bld Te1       in                        CBWN17456.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTACTGCAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT3537.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGCCGCAAACTTCACACGGAGAAATTTGGCTGACTATTTTTGCAGCAGGACCCCTTACCATGTCAATTTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTTTTACATGGATTACCTAGCAGCTTTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTTTGGATCGGTACTACAAACCAGACCTGCCAAGAGGGGGCGCGGTAGAACTTCTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTTTCCTGAGCCTGCCTTCCTTCCCAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGGCGATTCCTGCTTCAGGCCTTTAACCTTACCTTTCCCTGACTCGCCCCCTCCTTTTTTTTTTTATATATTAAGGGTAATTTGTACCCCTGTATGAAACAAAAAAATTACCCTGTGCATTTGCATGTGGGACTCCCCGG
  3   1   2       bld TpA  5g3  in                    TTpA059j24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCCGCAAACTTCACACGGAGAAATCTGGCTGACTATCTTCGCAGCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTTTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                    EC0CBA002DH08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGGACCCCTTACCATGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCCCTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGGACATTCACTGTGTTTACTAAGCAATTTGGGCTTAAAAAATGATCTTGCAAACCATGAAAGTTCCTTTCACTGTTTCCACATTTAATGATGTCCTGTTAAGGGATGTTGAACCCCAGTAAAAGGAATAAAAGATGAATCCTTCCATTTCTGAAACTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Lun1      in                         CABD6617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGGTAATTTATTTGTTTCATACAGTGGTACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCC
  5   1   2       bld Lun1      in                         CABD6617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCAATCTGCTGCTTGCTGGGTATGATGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGGTAATTTATTTGTTTCATACAGTGGTACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3       in                         CAAM5713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCC
  5   1   2       bld Te3       in                         CAAM5713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAACATGACGGACCCTCGTTGTATTACATGGATTACCTAGCAGCTCTAGCAAAAACGCGTTTTGCTGCACATGGCTACGGGGCTTACCTAACCCTCAGTATTCTGGATCGCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas086i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTACTACAAACCAGACCTGACAAGAGAGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG
  5   1   2       bld Gas                            TGas083p21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGACGCAGTAGAACTACTAAAGAAATGTATAGCAGAGCTCCAGAAGCGCTTTATCCTGAGCCTGCCTTCCTTCACAGTGAGGGTCATCGATAAGGATGGGATCCATGACTTGGAGACGATTCCTGCTTCAGGCCTTTAACCTTACCTCTCCCTGACTCGCCTCCTCCTTTTTCTTTTTATATATTAAGGTTAATTTGTACCACTGTATGAAACAAATAAATTACCCTGTGCATTTGCATGTGGGACTCCCAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)