Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 74%

 1012070797 Xt7.1-CABG3034.3.5 - 183 ESTs
                                                                       ..-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABG3034.3.5                                                     TGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAA
                                                  Xt7.1-CHK-1008222001                                                           ACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAAAAAA
                                                      consensus depths                                                          7     7     7     7    14    14    23    23    24    24    26    26    27    27    27    27    27    27    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    28    29    29    30    30    30    30    30    30    30    30    31    31    31    31    31    31    31    32    31    32    31    32    31    32    31    32    31    32    31    32    31    32    31    32    31    32    31    32    31    32    32    33    32    33    32    33    34    34    34    34    33    33    33    34    33    34    34    35    34    35    34    35    34    35    34    35    34    35    34    35    35    36    35    36    35    36    35    36    34    35    34    35    32    33    32    34    31    33    29    32    28    33    28    33    28    34    27    34    25    32    18    28    26    30    27    31    27    32    26    30    31    35    30    34    30    33    31    33    28    32    31    33    31    33    31    33    32    34    31    34    30    34    30    34    30    33    29    33    30    33    31    34    30    33    30    33    30    33    30    33    30    35    30    35    31    36    31    36    31    36    31    35    31    36    32    36    32    35    33    36    33    36    32    35    33    36    33    37    35    39    35    40    35    40    35    40    34    39    35    41    35    41    35    41    35    42    34    41    34    41    36    42    35    42    35    42    37    45    40    47    41    47    42    48    42    48    43    49    45    51    48    56    50    56    51    57    51    57    50    56    50    56    51    57    51    57    49    55    33    38    32    36    34    36    36    37    37    39    38    39    38    39    39    40    40    41    40    41    41    41    42    42    41    42    41    42    41    41    44    45    44    45    48    49    50    52    53    54    56    56    56    57    57    59    60    61    61    62    63    64    64    66    63    66    77    80    88    91    89    93    90    94    91    95    89    95    93    99    94   100    92    98    92    98    92    97    92    97    92    97    93    97    91    95    92    96    92    96    92    96    91    96    90    95    91    95    88    92    86    90    84    89    84    89    83    89    81    86    79    85    79    84    77    84    56    83    55    83    55    82    55    81    53    80    54    78    53    77    53    77    53    77    51    77    52    75    52    75    52    75    54    77    54    76    54    74    54    74    54    74    54    74    55    75    54    74    54    72    54    72    54    72    53    72    53    71    54    71    54    71    54    71    53    70    48    66    48    65    46    63    46    52    10    15
  5   1   2  SIG                                      Xt7.1-CABG3034.3                                                     TGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABD6259.5                                                                          GACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------A
                                               BLH MIN     204     223                                                     
                                               BLH MPR       3     223                                                     
                                               BLH OVR     204      22                                                     
                                               CDS MIN     204     223                                                     
                                               EST CLI      21      23                                                     
                                               ORF LNG     204       5                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 3e-041     NP_490664.2 Y74C9A.5 [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 2e-062     XP_796683.1 PREDICTED: similar to Sestrin-2 (Hi95) [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 9e-105     NP_611821.1 CG11299-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN --- Xt ---- 1e-131     CAJ81266.1 sestrin 2 [Xenopus tropicalis] --------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 0          NP_001002660.1 zgc:91970 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 0          NP_001013388.1 sestrin 1 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN --- Hs ---- 0          NP_055269.1 sestrin 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                             PREDICTED - Gg ---- 0          XP_419796.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          BAB33008.1 nuclear factor XPA26-T2 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 0          NP_001079869.1 sestrin 1,nuclear factor XPA26-T2 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABG3034.3.5                                                                                      TGA---------------------------------------------------------------------TGA------------------------------------------------------------------------------TGA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------ATG------------------------------------------ATG---TGA------------------------------------------------------ATG------------------------------------------------------------------------------------------TAG---------------------------------------TGA---------------------------------------TGA---------------------------------------------------------------------------------ATG---------------------------------------------TGA---TAA---------------------------------------------------------------------TAA------TGA---------ATG---------------TGA---TAG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------TAA------------------------ATG------------------------------------------------ATG------------------------------ATG---------------TAA------------------------------------------------------------------------------------ATG------------TGA------------------------------------------------------------------TGA---TAG---------------------------------------ATG------------------ATG------------TGA---------ATG---------------------------------TGA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2  SIG                                      Xt7.1-CABG3034.3                                                     TGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAA
                                                  Xt7.1-CHK-1008273036                                                           ACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAAAAAA
  5   1   2   10  ext Te1  5g3  in                         CBWN8289.b1 AAAGGGCTGAACTCGGTGCCAGTGTGCTGGGGAGCAGTAGGCAGCGGAACGCTGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCTGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCANAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTTATCAC
  5   1   3   10   nb Te1  5g3  in                         CBWN7692.b1 ....GGCTGAACTCGGTGCCAGTGTGCTGGGGAGCAGTAGGCAGCGGAACGCTGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGACCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGTGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTA
  5   1   3   14   nb Brn4 5g3  in                        CAAL22483.5p ............................................CGGAACGCTGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTTA
  5   1   2   14  ext Brn4 5g3  in                         CAAL9826.5p ............................................CGGAACGCTGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTT
  5   1   3   10   nb Tail 5g3  in                         CBSW9151.b1 .............................................GGAACGCTGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGACCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCT
  5   1   3   10   nb Thy1 5g3  in                        CBST5580.fwd ................................................ACGCTGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTANAGCCGGAGAACACAGCTGGTCTTTGGCAGAA
  5   1   2   10  ext Thy1 5g3  in                        CBST1452.fwd .................................................CGCTGGGGGACGGGTAACAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTANAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTT
  5   1   2   10  ext Ski1 5g3  in                        CABJ10120.5p ..................................................................CAACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGNCATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATAACCCCCGAATACACAGTGA
  3  -1   3        nb Liv1      in                         CAAR5980.3p                                                                    AACAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAA
  5   1   3   10   nb Ovi1 5g3  in                         CABI9952.5p .........................................................................GACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACA
  5   1   2   10  ext Spl1 5g3  in                         CABK8799.5p .........................................................................GACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCCGAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCT
  5   1   0       chi Ovi1 5x3  in                        CABI12064.5p                                                                            ATCGATTCGCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGTGAGTGTATGCACAGGATTTTGAACACTTATGACAGGTACTATGTACTACTATGACAGCTGTCGCATTGCTTCCACCCGCTTCTGGTCACTTCCCATTTGTATTCAAACTAGGGATGCACTGAACCTTTTATTTTAGTATTTGGACGAATCCCTCAATCCTTGTGTATGGATTCAGCCAAATATCAATCCAGATCTGAAGTAGAAGAAGAAATTTATGANAATAAAGGAGCATGGCAAATCTTTTTTAGTATATAGGGCTCAGATTACATTTTGCCACACTTNTGGATTCAGCCAAATCTGAATCCTGCTANAAATCCCAAACGAAATCCAGGATTCAGTGTGTCACTAATTCAAACA
  5   1   2   10  ext Ovi1 5g3  in                         CABI2523.5p ............................................................................ATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCA
  3  -1   3        nb Liv1      in                         CAAR7209.3p                                                                                     CTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTANAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATT
  5   1   3   10   nb Lun1 5g3  in                          CABD881.5p ....................................................................................CTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGT
  5   1   2   10  ext Ovi1 5g3  in                         CABI5924.5p ....................................................................................CTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCTCTGT
  5   1   3   10   nb Ovi1 5g3  in                          CABI689.5p ....................................................................................CTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGNCATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCC
  5   1   3   10   nb Ovi1 5g3  in                         CABI9815.5p ....................................................................................CTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTANAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAAATTACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCCATGGCA
  5   1   3   10   nb Int1 5g3  in                         CAAP8323.5p .......................................................................................AAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTATTCATGGCATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAA
  5   1   3        nb Lun1      in                        CABD13817.5p                                                                                        AAATATCAGCATAACATCCTTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGGATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGT
  5   1   4   10 seed Fat1 5g3  in                         CABC5669.5p ........................................................................................AATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATAACCCCGAAAACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATAATGCCAATGGCAACCCATGGAGTCAAG
  3  -1   3        nb Lun1      in                         CABD7636.3p                                                                                              CAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAA
  5   1   3   10   nb Int1 5g3  in                        CAAP11834.5p .....................................................................................................CATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACAT
  5   1   3   10   nb Sto1 5g3  in                         CABG9205.5p ..............................................................................................................ATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCG
  5   1   3   10   nb Int1 PIPE in                        CAAP13501.5p .....................................................................................................................CCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGGATTA
  5   1   3        nb Ovi1      in                        CABI11306.5p                                                                                                                                                               GAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGNCACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCT
  5   1   3        nb Fat1      in                         CABC9542.5p                                                                                                                                                                                                                                                                                             CACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGNCACTTCAAGAAGGAAGAGATGAAGAAGAAGNCAGTCAGGAAGAAGATGACACTCGTTTTGAGAGAGAGAAAACTGAAAGCA
  5   1   3        nb Liv1      in                         CAAR5303.5p                                                                                                                                                                                                                                                                                                      AGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAGGGAGAGATGAAGAAGAAGCCAGT
  3  -1   3        nb Int1      in                        CAAP11849.3p                                                                                                                                                                                                                                                                                                                                                           CGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATG
  5   1   3        nb Hrt1      in                         CAAQ9195.5p                                                                                                                                                                                                                                                                                                                                                                                          CAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGAATACAGCTGGGA
  5   1   3        nb Mus1      in                         CABH6529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTTCACTTGACTTATAATACTATGGCAATGCATAAAGATG
  5   1   3        nb Eye       in                         CCAX6278.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTAT
  5   1   2       add Fat1      in                         CABC2272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATACTTTTATTCAGTCTGTAGATAAGAAGAAATGGATATTTTTCTGCTGGTATAGTAGCTACTGCTCTCATGAACATGCAGCTAAGTAAATAAATTTCACATACAAAATCACCTTTGCCAGGGATGTCCAGCTGGAGGCCCACAAGTCggatgttgccctccaaagcatttttatggcctcccagttgctcagtggctccatagacttcattgtttgacatTTTTATAGAATTTGGCCTTCAAAACCACGTAGGAAAATTAAGTTGGAGAACACTGACCTAAGCCAATGTATTGTACCATAAATTTACAGGATAAAAAAAAAATCTTTAATCTCTTTTTCTGTAAATCACATATATTTAGCTCAGAATATATTATCTTTTTGCCTTGTAAGCATTAAAGTATCTGTATTCTGGAGATCACAATAGACTACTGCGCAGTAAACTGTTAATACGTTTACAGCATTCTGTTACGCTTTTAAGTGAATGGAATGACACGGTGAACCATGAGTGAAATATCTGGATAAAGTTTGCTTCATCTTTTTAGATACAAGTTGTAGAATTAGCTTCTTTCCAGAAATTCTACTTTAGAAACCTAAATATCAGACACATGGACACAGTTTATTCAAATGCAATGTAAAATTCACTGATCCCAGGATATTTAGATGCAGTGTTCTTTTTCTTGCCTACAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAAC
  5   1   3        nb Ova1      in                         CABE3368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCTTGTTAATCTTCATGTCCATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTTAGACGTGCAGTATGGAATTATGTCCACTGCATNGTTGGTATAAGATATGATGACTATGAT
  5   1   3        nb Ova1      in                        CABE11677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATGGATCGCAGCTTTAGGTTTACATTAAAAATGTGGTGTGCAGTCCTG
  5   1   0       chi Ovi1      in                        CABI14187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCGATTCGGCTCCATAGACTTCATTGTTTGACATTTTTATAGAATTTGGCCTTCAAAACCACGTAGGAAAATTAAGTTGGAGAACACTGACCTAAGCCAATGTATTGTACCATAAATTTACAGGATAAAAAAAAAATCTTTAATCTCTTTTTCTGTAAATCACATATATTTAGCTCAGAATATATTATCTTTTTGCCTTGTAAGCATTAAAGTATCTGTATTCTGGAGATCACAATAGACTACTGCGCAGTAAACTGTTAATACGTTTACAGCATTCTGTTACGCTTTTAAGTGAATGGAATGACACGGTGAACCATGAGTGAAATATCTGGATAAAGTTTGCTTCATCTTTTTAGATACAAGTTGTAGAATTAGCTTCTTTCCAGAAATTCTACTTTAGAAACCTAAATATCAGACACATGGACACAGTTTATTCAAATGCAATGTAAAATTCACTGATCCCAGGATATTTAGATGCAATGTTCTTTTTCTTGCCTACAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGGTGAGTGTCTACGTTTGACTGTGCTCATTGTCATTATCAAGTCTAAATCTAGGCATTAACGATAACATCTGCACATCTGTTTGGTGAGGTCTTCAGACCAGTGGTTCTTTGTCCAGTTTGGCCACCTGCACAGTGAGACAACATTAGTAGAAAACTTTAGGTGAAGGATAATGCAGTCTATATTTGACAGGATTTTTAAACCTGACCAGATGCCAATCAGACTGTTTGACACCCTAAAATGTTTAAATAGTTACT
  3   1   2       ext Spl1 5g3  in                         CABK8799.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTACCCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTT
  5  -1   3        nb Int1      in                        CAAP11849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGANATACACAGTGATGGTGTCACACCTTCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTT
  3   1   2       ext Ovi1 5g3  in                         CABI2523.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGCCACTACCACTCTTAGCTCTTCACATTTGGTTGTGGAATAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGAAAAAA
  3   1   3        nb Fat1      in                         CABC9542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAGCTTCTTTCACATTTGGTTGTGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   3        nb Hrt1      in                         CAAQ9195.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACATTTGGTTGTGGAATTAACCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAA
  3   1   2       ext Ovi1 5g3  in                         CABI5924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGCCTCTCGCCCTATAGGA
  3   1   3        nb Mus1      in                         CABH6529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAATTACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAA
  3   1   3        nb Ovi1 5g3  in                         CABI9815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAACCCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   3        nb Ovi1 5g3  in                          CABI689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAG
  3   1   3        nb Ovi1 5g3  in                         CABI9952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTGGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAG
  3   1   2       add Ovi1 5x3  in                        CABI12064.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   0       chi Ovi1      in                        CABI14187.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGTTTGACTGTGCTCATTGTCATTATCAAGTCTAAATCTAGGCATTAACGATAACATCTGCACATCTGTTTGGTGAGGTCTTCAGACCAGTGGTTCTTTGTCCAGTTTGGCCACCTGCACAGTGAGACAACATTAGTAGAAAACTTTAGGTGAAGGATAATGCAGTCTATATTTGACAGGATTTTTAAACCTGACCAGATGCCAATCAGACTGTTTGACACCCTAAATGTTTAAATAAGTTACTGACTTGATCTGTAGAGGGCCAAATCAGCAGCTTAATTCAGACCTTCCTCTATATTGAATTAGAATCATTAGAGATGTAAGAATTATGATGCCAGCGAGTTACGCAGCACTTTACAATAATTTATAACAAACAATAATCACACTCTATTTCATGACTGAAAGGGCTTTATGACAATTATTTCTATAAAATTCTTTAGAAAAAAAAGCCCTTTTAATAACAGCACTCAAATGAAAACAAGGCCTTTCTAGGGAGGATTTAAGAAGCTTCATGTTACGTTTTTCATATGCATGTTAAGTCTTAATGCAATTGCTTTGTATATTACAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  5   1   0       add Liv1      in                         CAAR8342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGAGGCACAATTGCTAGGTTAGAACCCAGGAATAGCTCCAAAATTGATTGTATTTGCTCCTTTCTCTTACGGTAGAAACAATATTATTTAAAAGGAACTCTAGGTTTATTACATACTAACAAACTGTGTTCCCAGTGTTACCTCCATTACTTGGACTATTGCACAATTATGAGTGGGCAAATTGTAACCCCCAATTTTAATTATTGTTATTCTTTATGTATATAGCGCCAACATATTTCTTGCCCCAGTGGAGCTTACAATCAAAGGCCCCCATCACATTTATACTGTGGTGTATAAGGAGCCAGTTAACCTGTATGTTTCTGGGTTGTGGGAGGATACCTCTGCAGACAAAGGGGAGAATATAAAAACTTCTTGCAGATAGTGCCCTGGCTGGGAATCAAACCTAGGACCCCCACTCAAGAACATTACTGTGCTACCTATTGTGCTGCTATGTTATTACAGCTTTTAGCTTTCCCTGACAGCCCAAGGTTGCCCTCAGGAGCTGGTAGTTGTTTTTAAAAACATCTGTAGAACTGCAGGTTTTCCAGAACAATTACCCCTTTATATGCCTTTTGGCTTCCATTATTATTATTTTTCTTCATGTTCTTTCTAACATGTTCTGTTACTCTTTACATTTCCCACTCTTAAGATTTCTTAAATATTCTGTATAGAAATATAGTTTTTCTAATATTATCCCTTTTTTCCCCTAGGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCCTCTACCTGAC
  3   1   2       ext Thy1 5g3  in                        CBST1452.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   3        nb Ovi1      in                        CABI11306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACACCTTCCGCCCCTTCCTTCTGTCAGGCAATTACTGGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGAAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGAAACAGGCAGAACTGCTTTC
  3   1   3        nb Int1 5g3  in                         CAAP8323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACTTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   3        nb Sto1 5g3  in                         CABG9205.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAAAAGCCTCT
  3   1   3        nb Brn4 5g3  in                        CAAL22483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   3        nb Lun1      in                        CABD13817.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   2       ext Ski1 5g3  in                        CABJ10120.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAGCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAG
  3   1   2       ext Brn4 5g3  in                         CAAL9826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGCAACTACTGTATATGTGATATGCCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTGGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTAC
  3   1   3        nb Te1  5g3  in                         CBWN7692.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAACTACTGTATATGTGATATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTGTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCGCGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGCGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGAAAAAAAAAAAAAAA
  3   1   3        nb Thy1 5g3  in                        CBST5580.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTGCCAATGGCAACCATGGGAGTCAAGAAGGCCATTATCCTCTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   3        nb Tail 5g3  in                         CBSW9151.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCATGGGAGTCAAGAAGGCCATTATCCTGTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCGCGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGCGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAAAAAAAAAA
  3   1   3        nb Ova1      in                         CABE3368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGGAAGTGTAAAACTTACAGACTCCTCTTGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  3   1   3        nb Eye       in                         CCAX6278.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTGAGGTTGAAGCTTTGATGGTAAAGATGAAGCAACTTCAAGAAGGAAGAGATGAAGAAGAAGCAAGTCAGGAAGAGATGACAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  5   1   2       add Ovi1      in                        CABI10632.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTACTTGGACTATTGCACAATTATGAGTGGGCAAATTGTAACCCCCAATTTTAATTATTGTTATTCTTTATGTATATAGCGCCAACATATTTCTTGCCCCAGTGGAGCTTACAATCAAAGGCCCCCATCACATTTATACTGTGGTGTATAAGGAGCCAGTTAACCTGTATGTTTCTGGGTTGTGGGAGGATACCTCTGCAGACAAAGGGGAGAATATAAAAACTTCTTGCAGATAGTGCCCTGGCTGGGAATCAAACCTAGGACCCCCACTCAAGAACATTACTGTGCTACCTATTGTGCTGCTATGTTATTACAGCTTTTAGCTTTCCCTGACAGCCCAAGGTTGCCCTCAGGAGCTGGTAGTTGTTTTTAAAAACATCTGTAGAACTGCAGGTTTTCCAGAACAATTACCCCTTTATATGCCTTTTGGCTTCCATTATTATTATTTTTCTTCATGTTCTTTCTAACATGTTCTGTTACTCTTTACATTTCCCACTCTTAAGATTTCTTAAATATTCTGTATAGAAATATAGTTTTTCTAATATTATCCCTTTTTTCCCCTAGGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAG
  3  -1   3        nb Int1      in                         CAAP3179.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTGCTACAGAAGATGAAGACCCTCCCCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAAGTGAATGTGTGA
  3   1   3        nb Ovi1      in                        CABI11147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGAAAAAAAAAGCCTCTCG
  5   1   3        nb Ovi1      in                        CABI11147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCAGATATAGATGTTTCCCGGCATTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGAAAAAAAA
  5   1   3        nb Fat1      in                         CABC4357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTGAAGATACAAGTTATGGTTACAAAGATTTTTCACGGCGGGGGATGCATGTGCCTACCTTTCGGGTGCAGGATTACAGCTGGGAAGACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCANGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTC
  5   1   3        nb Thy1      out                       CBST9488.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACCATGGCTATTCACTAGTTAATCGCCTTTATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGT
  5   1   2       add Mus1      in                         CABH2803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCCAGATGTTGGGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTT
  5   1   3        nb Tail      in                        CBSW12250.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGCTATTAGATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGA
  3   1   3        nb Ova1      in                        CABE11677.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGAAAAGTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGG
  5   1   2       add Thy1      in                       CBST12158.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAACACGCCAAGGTGCAGGCAGCCAAATTAGCTAAATGACAGTTCTACATGAACACTGCTATA
  5   1   2       ext Sto1      in                         CABG2387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCACATTGCTTTCAACTTGACTTATAATACTATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAAGCTAGTTAAAGAGACTTACAAAATACATTT
  5   1   3        nb Tad5      in                         XZT26877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCCAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACCAAATACATTTGTGCATGC
  5   1   3        nb Brn4      in                         CAAL7850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGATACTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCCAGGTCCATCTCGCTC
  5   1   3        nb Spl2      in                        CBSS5681.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTCAACTTTAAGACGTGCAGTATGGAATTATGTCCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTANATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAG
  5   1   2       add Tad5      in                         XZT35814.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCGATTCAATTCGTCGACCCACGCGTCCGATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTAT
  5   1   3        nb Hrt1      in                         CAAQ8342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTATGGAGAAATCAACCAATTATTGGATCGCAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACT
  3  -1   0       chi TpA       ?                     TTpA060i13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTTTTTTTTTTTGTTTCTTAAGTTTTATTTAAAAAAAATGTCAATAATACTGACAGACTTTGAAAAAACAAAGTTTCATAGCATATTCTCATGTTGATATTTCCATAACACAATGGGTTTCATCCATTTTAAACAGTTTTCCTTTTGCCTCCCTCAAAGTCAGAATCTAAAATCAGATCTGAAACTCAATGTTAAGAAAGAGAAATAAAAAGGCTGTCCTTTTTTCTGAAAAATTCTGCAGTCACGAGGAAGTCTGCATTGCACGAGCCAGTTTTCCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTT
  5   1   2       ext Ovi1      in                        CABI11935.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCTTTAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATA
  3  -1   3        nb Lun1      in                         CABD5431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTAT
  3  -1   3        nb Fat1      in                         CABC1380.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCGAGAGGTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCA
  5   1   3        nb Ovi1      in                        CABI10487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTACATTAAAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGGTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGT
  3  -1   3        nb Sto1      in                          CABG839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAATGTGGTGTGCAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTT
  5   1   3        nb Hrt1                                 CAAQ7503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTCCTGAGAAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAG
  5   1   3        nb Hrt1      in                        CAAQ11880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGACTTCAAAGAGAATGTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATNTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCT
  5   1   3        nb Tad5      in                         XZT65762.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTATGATGGTTTTTGGAGACAGTTTAAGCACTCTGAAAAAGTACATTTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTT
  5   1   3        nb Ovi1      in                         CABI8045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGTTTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAG
  5   1   3        nb Bone      in                       CBTC10366.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTT
  5   1   3        nb Spl1      in                         CABK9109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAAGCACTCTGAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATT
  5   1   3        nb Sto1      in                         CABG4626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTTTTCCCCTAGGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAGGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCC
  5   1   3        nb Int1      in                        CAAP11504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCTGAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCC
  5   1   3        nb Tad5      in                         XZT50216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAAAGTACATGTTAATTTGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGGATGTAGAATACCTCTTGGGT
  5   1   3        nb Neu                            TNeu001f10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAACTACAAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAAGTTCCATCTCGCTCTTTG
  5   1   3        nb Ovi1      in                         CABI8799.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGA
  5   1   3        nb Sto1      in                         CABG6469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGAACACAGGCAGGAAACTGGCTCGTGCATGCAGACTTCTCGTGACTGCA
  5   1   3        nb Liv1      in                         CAAR8022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAAC
  5   1   2       add TbA       in                   TTbA022o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGACTGAAATAAATCCCACAGTGCTGACATTTCTGCATCTCGAGTGCTGCTTTGTGCAGCTGCCTTTTCAAATCTCCTTTGCGCCGTATTTCTCATCGTATCAAACTGTTGGCTTACTGCCGCCGAGCCTTTGTAGCCTCCTTGCCTTTGATTGTGCGAATAACATATGTCCAGATCTGGCCTTGTGCCTGATTACTTGAACTTTGCTTTATTATATATGCACATGTTACCTGGCTTTCTTGATAAGGTTTCTGAGGCTATTGCGTTATATGTTTCCAGAAGATGCAGTGGGATATCCCCTCCTATTTTCTCCTGAGGTGCTTTTATGTTTGAGATTCAGATGGAGTGCGTACATCTTTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGATTTTTTTGTTTTTCTTCAGTCTTCNAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTA
  5   1   3        nb Tail      in                         CBSW1309.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAACTACAAAAAATAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTTGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAAC
  5   1   3        nb Ova1      in                        CABE10398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGAATTCGGCCGAGGGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAANAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTT
  5   1   2       ext Sto1      in                         CABG3034.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAGGAAAACTGTTTAAATGGAT
  3   1   3        nb Liv1      in                         CAAR8022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCT
  5  -1   3        nb Fat1      in                         CABC1380.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGATGCCAAGTTCTGGCCTTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCA
  3   1   2       ext Sto1      in                         CABG3034.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAATTAAAAAAGCCTCTCG
  3   1   4      seed Fat1 5g3  in                         CABC5669.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGTTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCNTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAA
  3   1   3        nb Sto1      in                         CABG4626.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCACATATGCTTGACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGTTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAGGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAA
  3   1   2       ext Ovi1      in                        CABI11935.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATATGCTTGAACTTGCTTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Ova1      in                        CABE10398.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAATT
  3   1   3        nb Sto1      in                         CABG6469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCNTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAA
  3   1   2       add Mus1      in                         CABH2803.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Ovi1      in                         CABI8799.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCTTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Int1 5g3  in                        CAAP11834.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTT
  3   1   3        nb Spl1      in                         CABK9109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAATTAC
  3   1   3        nb Ovi1      in                         CABI8045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAAAAAAAAAAA
  3   1   3        nb Int1 PIPE in                        CAAP13501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGATGGACTGGGATATCCCCACCTATTTTCTCNTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Ovi1      in                        CABI10487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATGGACTGGGATATCCCCACCTATTTTCTCNTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   2       ext Mus1      in                         CABH1547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATATCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  5   1   2       ext Mus1      in                         CABH1547.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATATCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Hrt1      in                        CAAQ11880.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAA
  3   1   3        nb Hrt1      in                         CAAQ8342.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Liv1      in                         CAAR5303.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Fat1      in                         CABC4357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCNTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Int1      in                        CAAP11504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  5  -1   3        nb Liv1      in                         CAAR5980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Lun1 5g3  in                          CABD881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAACTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   2       add Tad5      in                         XZT35814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAG
  3   1   2       ext Sto1      in                         CABG2387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Tad5      in                         XZT65762.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAG
  3   1   2       add Thy1      in                       CBST12158.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTAAATAAAACTTAAGAAACAAAAT
  5  -1   3        nb Lun1      in                         CABD7636.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Tad5                                 XZT71827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAG
  3   1   3        nb Brn4      in                         CAAL7850.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  5  -1   3        nb Liv1      in                         CAAR7209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  5   1   3        nb Bone      in                        CBTC2731.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTTGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAGTCTGTCAGTATTATTGAC
  3   1   3        nb Bone      in                        CBTC2731.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTTGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  5  -1   3        nb Int1      in                         CAAP3179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTAGAGGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTT
  3   1   2       add Liv1      in                         CAAR8342.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   2       ext Te1  5g3  in                         CBWN8289.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAAAAAAA
  3   1   2       add Ovi1      in                        CABI10632.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTTTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTTTTTCAAGCTGCTGCTTTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATTTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACC
  3   1   3        nb Liv1      in                         CAAR1122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  5   1   3        nb Liv1      in                         CAAR1122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAAC
  3   1   3        nb Tail      in                        CBSW12250.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAAAAAAA
  3   1   3        nb Spl2      in                        CBSS5681.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   2       add Fat1      in                         CABC2272.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Bone      in                       CBTC10366.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   0       chi TbA       in                    TTbA022o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACTTCAGAGGAAGAGAAAACACGCCACAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTCCATGAACACTGCTATAGTGTGAGCTTAGTTAAAGAGATTTACAAAATACATTTGTGCATGCTGTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTCGTTTTTTTCTATATTTTTTTTTCATAATGGTGGAAACTTAAGTTGTCTTCCTAAAAAATGAACATATGTCATTGGGTGGTTGCACAGTCTCACAGTGGGTATGTTCTATATTATAAAAGGCCTACAGGGAACGTAGAATGCCTTTTGGTTATGGGGTGCTCACTTTGGGAACAGTCCCTATCTTTGTTGCAAGCGGAGCCTGTGTTATTAGCGGTTGGGAACAAAGGACCACAGGCAGGAAAATTGGCTCGGGCAACGCAGATTTCATTTTGCCGGCTGAATCTTTCTGAAAAAAGGACGGCTTTTGCATTTCTCTTTCAAAACAGGCAGTGTCGGATCTGGTGGAGATTCTGCCTCTCAGGGAGGCAGAAGGCAATCTGTCTAAATTGGAGGAAGCCGCGTTTGTTAAGAGAAATAATCACCACTGGGCCTGCCCTATGAAACTTTGGAGTGTCAAAGTGTGCACAGTACAATAGACATTCTCCTTACCCCGTGGTTAAGAAACAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Tail      in                         CBSW1309.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTTGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAATCTTAAGAAACAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                         XZT26877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAG
  3   1   3        nb Kid1      in                        CABA10007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  5   1   3        nb Kid1      in                        CABA10007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                         XZT50216.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCCAAATTAAGCTAAATGCCAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTGGGCTATGTGTTTAGTTATAAGAAACTGGGAGGTTGGTTTTTTTCAATATTTTTTTTTCATAAGGGTGGAAACTTAAGTTGTCTTCCTAAAAAAGGAACATAGGTTTTTTTGTTTTTCTCCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTCCAGGGAATGTAGAATCCCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACCCAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCACCATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAGGAACC
  5   1   0       chi Ovi1      ?                          CABI7694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATGCAAGGAAGTATGTTGCCTTGTATGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAA
  5  -1   3        nb Lun1      in                         CABD5431.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  5  -1   3        nb Sto1      in                          CABG839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAATT
  5   1   3        nb Thy1                                CBST7776.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTATATTTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTCTGTTACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAG
  5  -1   0       chi Sto1      in                         CABG1804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTTTTTTTTTTAGTGAAATGATCACTTTATTTGCTCTTGAGAAACCTTTATTGAGTATCTAGACTCTACATCAGGACTGAAAAGGTTCCTCGGGGGAGGGAGAAAGAATAGAGGGCAGGGATTTAGTTGGCAGCAATGGTGTTCTGGATCCAAGACACATAGTTGCAGACCTTGGTGTAGACACCGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTG
  3  -1   0       chi Sto1      in                         CABG1804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGAAATGATCACTTTATTTGCTCTTGAGAAACCTTTATTGAGTATCTAGACTCTACATCAGGACTGAAAAGGTTCCTCGGGGGAGGGAGAAAGAATAGAGGGCAGGGATTTAGTTGGCAGCAATGGTGTTCTGGATCCAAGACACATAGTTGCAGACCTTGGTGTAGACACCGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTG
  3   1   3        nb Sto1      in                        CABG11810.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAATTAA
  5   1   3        nb Sto1      in                        CABG11810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAATTAAA
  5   1   2       add TpA       in                   TTpA055j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGCGGCCGCTTATTTTTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCTAACATTGAGTTTCAAATCCGATTTTAAATTCCGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCCTTGGGTTATGGAAATATCAACATGAAAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   2       add TpA       in                    TTpA055j14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAAGTGGATGAAATCCCAATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABD6259.5                                                                          GACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAA
                                                  Xt7.1-CHK-1008273040                                                                                GTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAG
  5   1   4   10 seed Ski1 5g3  in                         CABJ1649.5p .....................................................................CAGTGACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTAAAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAAT
  5   1   2       ext Lun1      in                         CABD6259.5p                                                                          GACATTGTGTTCTGAAATATCAGCATAACATCATTCTATAAGCCCCCGTCAGCTCCCAAAGCGAAGCCTGTAAGAAAGGGCAAGTGAGGTTTTTGTGTTAATAAAGCAGCCCGTGGACTAACAGCTTTGCCCATCCATTTGCCGAACAGAGCTTTGTCTGCACACTGACAGGACGTGAGGACGATGAGGTTATCTCCCCGGGCAGCTCTCTCACCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGACCACTAGGACAGGGGCCGAGCAGATTTGTTCCAGAAGAAGAGATTCTGCAGGTGGGAAGTGAGGATGCAAACATGCATTCTGTGTTTGCTGAAACTTTTGCAGATTTCGGTCGCTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGACAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGATGGCCCCCTTTCACCTTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTAAACAAGATGCTAGCACACAGGCCATGGCTCATTACAAAAGAGCACATTGAGAAATTGCTTANAGCCGGAGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCCCACTACCACTCTTTAGCCTCTTTCACATTTGGTTGTGGAATTAACCCCGAAATACACAGTGATGGTGGTCACACCTTCCGCCCTCCCTCTGTCAGCAACTACTGTATATGTG
  3  -1   2       ext Sto1      in                         CABG8852.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTTCTTATGGAAGCGAGGATGCAGGCAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCTTCTACCTGACTTAAGGAAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACACATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTA
  5   1   3        nb Thy1      in                         CBST986.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGTCCGCGGACGCGNNTGGGAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTTCTTTCAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGAACACAGGCAGGA
  5   1   2       ext Sto1      in                         CABG6204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAGAAAAAAAAACTACAAAAAACAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAAACAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGC
  5   1   2       ext Sto1      in                        CABG12490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAAAGAATGTTGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTNCAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCA
  5   1   3        nb Mus1      in                        CABH11013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGTTTCCCCAGCTCGCATGGAAACTACGGCAGCTGCCTTTTCAGAAATCCTTTGTGCCATATTTCTCATCGTATCAACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTC
  5   1   3        nb Egg                            TEgg088h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACTGTTGGCTTAGTACCACCGACAACTTGTAGCGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCA
  5  -1   2       ext Sto1      in                         CABG8852.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACACATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAA
  5   1   3        nb Panc      in                        CBTA1954.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCATACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTT
  5   1   3        nb Spl2      in                        CBSS9419.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGAAGAAGAGATGCCAAGTTCTGGCCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTG
  3   1   4      seed Ski1 5g3  in                         CABJ1649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   2       ext Sto1      in                         CABG6204.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGTGCCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   2       ext Sto1      in                        CABG12490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACATATGCTTGAACTTTGCTTTATAATATAGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAGNAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAAAAGCCTCTCGC
  3   1   2       ext Lun1      in                         CABD6259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCACATGTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Mus1      out                        CABH4903.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTACCTGTATATCAGGATATGGTTACAATGGTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Mus1      in                        CABH11013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGATATGGTTACAATGTTTATAATGAAAGACATTTCAAGAGGATGGACTGGGATATCCCCACCTATTTTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC
  3  -1   3        nb Ovi1      in                         CABI7874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAA
  5  -1   3        nb Ovi1      in                         CABI7874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTCCTTAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAACAAAAAAA
  3   1   3        nb Thy1      in                         CBST986.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Spl2      in                        CBSS9419.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGTGCACACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTAAATAAAACTTAAGAAAC
  3   1   3        nb Panc      in                        CBTA1954.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATACAAAAATGAGATTAAGATGGCACTGCTACTTCAGTAAATGACTTTAGAGGAAGAGAAAACACGCCAAGGTGCAGGCAGCCAAATTAAGCTAAATGACAGTTCTACATGAACACTGCTATAGTCTGAGCCTAGTTAAAGAGACTTACAAAATACATTTGTGCATGCTCTAAAGCTAGCCATACAAGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTCGCTCTTTGGCTATGTGTTTAGTTATAAGAAACTGTGAGGTTTGTTTTTTTCTATATTTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAAATGTACATATGTTTTTTTGTTTTTCTTCAGTAGGTATGTTCTATATTATAAAATGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTGCTGATACTAGCAGTTGGGAACAAAGGAACACAGGCAGGAAAACTGGCTCGTGCAATGCAGACTTCCTCGTGACTGCAGAATTTTTCAGAAAAAAGGACAGCCTTTTTATTTCTCTTTCTTAACATTGAGTTTCAGATCTGATTTTAGATTCTGACTTTGAGGGAGGCAAAAGGAAAACTGTTTAAAATGGATGAAACCCATTGTGTTATGGAAATATCAACATGAGAATATGCTATGAAACTTTGTTTTTTCAAAGTCTGTCAGTATTATTGACATTTTTTTTAAATAAAACTTAAGAAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)