Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 97%

 1012070839 Xt7.1-CABI12176.5.5 - 288 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        3     4     4     7    10    15    34    38    46    53    56    62    59    63    63    63    64    64    64    64    63    64    64    64    64    64    63    64    64    64    66    66    65    66    64    65    64    65    63    65    65    66    66    66    67    67    72    72    72    72    72    72    71    73    71    73    72    73    72    73    75    76    75    77    75    77    76    78    75    79    78    80    78    81    80    83    78    83    80    83    81    82    80    82    79    82    84    85    84    85    82    85    83    84    82    84    81    85    80    84    80    83    79    81    78    80    77    79    72    77    68    73    68    72    67    74    68    75    68    76    69    77    69    74    67    74    63    69    62    67    63    68    62    66    58    62    59    63    58    61    58    61    53    56    51    57    49    55    47    54    49    54    49    55    44    48    43    47    42    45    41    45    41    45    29    33    20    23    19    22    18    19    18    19    18    19    18    19    17    18    17    18    18    19    18    19    18    19    19    20    21    22    21    22    21    23    17    19    19    21    21    24    21    24    22    24    25    26    27    29    27    29    27    29    28    32    32    34    33    36    33    37    36    39    35    37    36    38    35    38    37    40    38    41    38    41    38    41    39    41    37    38    38    39    38    39    39    40    41    42    41    41    42    42    42    42    44    44    44    44    42    44    42    44    41    43    40    43    42    44    43    45    40    43    41    43    41    43    42    44    43    45    44    46    45    47    46    48    45    47    45    47    46    48    46    48    46    48    45    48    45    48    43    48    42    49    44    50    46    50    46    50    46    50    45    49    47    51    48    52    43    50    44    49    43    47    44    48    43    47    44    48    44    46    44    46    44    45    45    46    41    48    39    49    36    45    30    41    30    38    30    39    30    39    33    38    34    39    34    41    35    40    33    39    33    39    33    38    34    38    33    38    34    40    20    40    22    40    22    38    23    41    23    42    26    49    27    51    30    53    29    53    32    59    33    62    34    64    39    70    40    76    39    78    40    79    43    81    42    82    46    91    50   103    48    98    79   100    49   103    52   106    52   106    52   107    54   111    54   110    53   110    54   108    54   108    54   109    56   109    57   109    58   112    59   111    58   111    57   109    83   108    86   107    83   107    81   107    85   107    83   104    83   104    82   104    84   105    84   106    84   106    80   104    83   104    83   104    83   101    84   102    84   102    64   102    66   101    64    98    65    98    61    98    62    98    61    97    61    96    65    97    58    96    64    96    60    95    60    95    58    90    55    88    54    87    50    85    49    83    47    80    43    75     7    24     8    12     3     6     3     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTTTAAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATGTTTACTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CG----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -T-C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------A-G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                               BLH ATG      46    2542                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN      46     296                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MPR      40     296                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR      46      89                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               CDS MIN      46      50                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               EST CLI      28      50                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG      46      14                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Ce ==== 1e-164     NP_505950.1 SKIP SNW domain (60.2 kD) (skp-1) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 0          NP_511093.2 CG8264-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 0          XP_001188665.1 PREDICTED: similar to SKI interacting protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Mm ==== 0          XP_910294.1 PREDICTED: similar to Nuclear protein SkiP (Ski-interacting protein) (SNW1 protein) (Nuclear receptor coactivator NCoA-62) [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 0          NP_001002864.1 SKI interacting protein [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 0          XP_421294.1 PREDICTED: similar to Nuclear protein SkiP (Ski-interacting protein) (SNW1 protein) (Nuclear receptor coactivator NCoA-62) [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_036377.1 SKI-interacting protein; nuclear receptor coactivator, 62-kD; BX42, Drosophila,homolog of [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          AAI08752.1 MGC132028 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = ?? ==== 0          NP_001089903.1 hypothetical protein LOC734970 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          CAJ83628.1 SKI interacting protein [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABI12176.5.5                                                                                                                                              ATG------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------TAATAA------------------------------------TAA---------------------TGA------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------ATG------------ATG------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TGA------------------TAA---------TAATGA---------------------------------------------------------TAG---------------------------------------------------------------------TAA---------------------------------------------------------------TAG---------------------------ATG---------------------TAG------------------------------------------------------TGA------------TAA------------------------------------------TAA---------TAA------------------TAGTAG---TGA---------------------------------------------TGA------------------TGA------------------------------ATG---------------------------------------------TAA---------------------------------------------------------TAA------TAG---------------------------------------------------TGA------------ATG------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TAA---TAA------------------------------------------TAG---------------TAA------------------TAG---------------------------------ATG---------TAA------------------------------------------ATG------------------ATG---------------------TGA------------------------------------TAG---------------TGA---------------------------------ATG---------------------------------------------TAA------------ATG------------------------------------------------------------------------------------------------------------------------TGA---------------TAA------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   3        nb Egg0      in                         dad63d09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGAGGAGGACGAAGGGAAAATGGCGCTGGCCAGTTTTTTGCCTGCTCCAACGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCGCAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATATTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTT
  5   1   3        nb Gas  5g                        TGas007o03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGGAGGACGAAGGGAAAATGGCGCTGGTCAGTTTTTTGCCTGCTCCAACGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTAATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTG
  5   1   3        nb BrSp      in                    EC0CBA004AC03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGGACGAAAGGGAAAATGGCGCTGGCCAGTTTTTTGCCTGCTCCAACGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTG
  5   1   2       add Gas7      in                         XZG18009.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGGACGAAAGGGAAAATGGCGCTGGCCAGTTTTTTGCCTGCTCCAACGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCGCAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCATGTATT
  5   1   3        nb Neu  5g                        TNeu136m20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAAAGGGAAAATGGTGCTGGCCAGTTTTTTGCCTGCTCCGGCGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCGCAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGGGGGGCGTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCGAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTGATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTGCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTGCACACCCTCTCAGCA
  5   1   3        nb Neu  5g                        TNeu128d24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAGGGAAAATGGCGCTGGCCAGTTTTTTGCCGTGGGCGGCGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCGCAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCGGGTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAAAGGCGAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTGATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAGACAATTAAAGAGCTCACAGAGAAGA
  5   1   3        nb Gas  5g                        TGas041n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAATGGCGCTGGCCAGTTTTTTGCCTGCTCCAACGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATATTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTTTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTNTTAACTCTGGTGC
  5   1   3        nb Gas  5g                        TGas072p15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAATGGCGCTGGCCAGTTTTTTGCCTGCTCCAACGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTTTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAG
  5   1   3        nb Egg                            TEgg108g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCTGGCCAGTTTTTTGCCTGCTCCAACGCACTTATCACAGGACCAATTATAGGCAGAAGAAAAGCTGAGAGCGCAGAAGTCTCGTCACACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCGGCAAGTACGCAGACCTGGTACCTAAAGACGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAATGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAACTGCAAATAAATTGGC
  5   1   3        nb Gas       in                   TGas081p12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCTGGCCAGTTTTTTGCCTGCTCCAACGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAGGATCCAATGGAGC
  5   1   3        nb Gas                            TGas013a10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGTTTTTTGCCTGCTCCAACGCAGTTATCACAGGACCAATTAGAGGCAGAAGAAAAGCTGAGAGCACAGAAGTCTCGTCAGACCGCGTTAGTTGCATCGCGCCGTGAACCACCTCCCTATGGCCACAGAAAAGGATGGGTACCCAGATCCCTTGAGGATTTTGGAGATGGCGGTGCTTTTCCAGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTTTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCTTTTGGTTTGGACAAGTTCTT
  5   1   3        nb Gas       in                   TGas132k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGCCACAAAAAAGGATGGGAACCCAAATCCCTTGAGGATTTTGAAAATGGCGGGGCTTTTCCAAAAATACTTGGGGCACAATATCCACTGGACATGGGCCGCAAAAAAAAAATGTCCAATGCCTTGGCTGTGCAGGTCAATGCAAAAGGCAAAATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCACCAAGTACACAAACCTGGTACCTAAAAAGGTGATGGATGAAAATGATCCTGACCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAAATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGGAAAATACCCCCATGTATTTCTAACTG
  3   1   3        nb Gas7                                 XZG29013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGATACATGTGGCACAATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAGTTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAG
  3   1   3        nb Gas7      in                         XZG58882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATATCCACTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGG
  3   1   2       ext Gas7      in                         XZG52871.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAG
  3   1   3        nb Egg       in                    TEgg063f15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGACATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG53872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAGAAGAAAGAGAGAGACCGGG
  3   1   3        nb Gas7      in                         XZG25649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGCCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGC
  3   1   3        nb Spl2      in                        CBSS6931.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCAAAAAGAAAATGTCCAATGCCTTGGCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAG
  3   1   3        nb Neu5      in                         ANHP1022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGTGCAGGTCGATGCAGAAGGCAAGATAAAATATGATGCTATTGCTCGTCAGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAG
  3   1   3        nb Ova1      in                        CABE10938.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAG
  5   1   3        nb Ova1      in                        CABE10938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGGACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Hrt1      in                         CAAQ2289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAGTCCAAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCA
  5   1   3        nb Tad5      in                         XZT34226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGATAAGGTCATTTTCAGCAAGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas7      in                         XZG28999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTACACAGACCTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAGTTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGAAAATGAGAGCCCAGGTGGAGCGTAAGATGGCG
  3   1   3        nb Egg0      in                         dad63d09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGTACCTAAAGAGGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTATAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAAAAA
  3   1   3        nb Gas8      in                          st75f01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGATGGATGAAGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCA
  5   1   3        nb Brn4      in                        CAAL20404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAA
  5   1   3        nb Gas8      in                          st75f01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGATCCTGAGCTACAAAGACCTGATGAGGAAACAATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCANAAGGAGAAAGAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG28999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGCTACAAAGACCTGATGAGGAAACAGTTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAAAAAAAAAAAAAGG
  5   1   3        nb Neu                            TNeu144l12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGTGATGAGGAAACAATGTAAAGAGCTCACAGTAGAAGACAAGACAGGCTTTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTATGTACACACCCTCTCATCAGGGAGTGGCTTTTAACTCTGGTGCCAATCATAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCATCACCAGTAATGCATTCTCCCATCAGAAAGATGACTGTGAAGGAACAGCAAGAGTGGAAAATACCCCCATGTGTTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTATATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCATACTGTCCATATCAATGAGAACTTTGCTAATCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCATGTGGAGCGTAAGATGGCGCATAATGAGAAAGAGAAAAAGGAGGAAAAACTTATGGAACTGGCACATATCGCAAGGGAACGCATAGCTGGGATAAAGTCCCATACAGAC
  3   1   0       chi Neu       in                    TNeu089n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAAGTAGACTAGAGCCGGGAGTATGCAGGAGGAAGTGGAGGTGCAGGGCAAAGCCGGGCCCGGTGGGAGGCTGGATATGAATCACGGCTTCGTTCACCATATCCGGCGGAATCAGATCGCGAGGGATGACTATGACCGTGAAGTGAAGCAA
  5   1   2       add Neu       in                   TNeu089n19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAAAGAGCTCACAGAGAAGACAAGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGTGGAGCGTAAGATGGCGCAAAGGAGAAAGAGAAAA
  3   1   3        nb BrSp      in                    EC0CBA004AC03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGGACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAAAAAAAAATTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                  XZG8680.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCANAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACAAAGCAGGNGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCAT
  5   1   3        nb Tad5                                 XZT70940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCTGCACAGTATATTAGGTACACACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGNGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGA
  5   1   3        nb Te4       in                         CAAN3918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCCTCTCAGCAGGGAGTGGCTTTTAACTCTGGTGCCAAGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTG
  5   1   3        nb Gas7                                  XZG9176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAGAGGGTGATTCGGATGGTGGAGATGCAAAAGGATCCAATGGAGCCACCTCGATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTANAATACAGATAATGATGTATATGGTGATGACCTGGACACCTT
  3   1   2       add Gas7      in                         XZG18009.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAGAGAAGACACGACAGGCTCTGGAAAAATCAGTGTCCCAAAAGATTGCTGCTGCAATGCCTGTACGAGCTGCAGATAAATTGGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAG
  5   1   2       add Brn3      in                         CAAK9058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTCTTTATATTTAAGAGCTGCCCATACCTGTAGAGACTGCTACATTGCTTGTTTTATTTCTGTTAAGGCAATAAGTCTTTCATAGAATTTCAGCTAGATTTGTAGCTGGGTGTAAAGCTTGCTCTAGTGTAGCCCATAAAAGTTAATTTAATAGTCTAAACCACACCTTTTAATGTGCAGTCAATTCTTCTGCAAAATCACTTATAAGTTACGTGAGACCCCTGGATAGAGATAATGTTCACTTAAAATATCACTGAGCCAGGGTACTAATTTTGTGTCACTGTGTACTTGTATATTGTTGAGATGACCATAAAACTGACAAACAGTACTGCTGTAGATATGCCATATTGCAATTTTCTTCCTGTTCTTGGATCTTCTGTGCAGCCCCAGGCTGAATGCCCATGCACAGCATGCGCACCTGGACCAACTGAATGCAACAATTTTTGTTCACACAATGCAATTTGATTTGAACAAATTTGAGTATACAAATTAAGAGATTTATCTCAATACTAAACAAATTATAAAATAACTGATTTGGTGCAACACCATTAAGGTATGCGTGTGACTTTCTTTGATACTCATTAACAGAACTTATTCATTCTTGGTTCTTACCATAGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTGAGTGTGGGTGACTCTGAAAAGTGACTGATGTACTAACATGGA
  5   1   3        nb Gas                            TGas036d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCGATTTAAAATTAAAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAG
  5   1   3        nb Gas7      in                         XZG23393.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAG
  5   1   2       ext Ski1      in                         CABJ2597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTAAAATTAATAAGAAAATTCCACGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGG
  5   1   3        nb Fat1      in                         CABC5078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATTCCCGTGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCANGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAAC
  5   1   3        nb Neu                            TNeu035b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGTGGGGCCTCCATCTCCTCCAGCACCAGTAATGCATTCTCCCACAGAAAGAGACTGTAAAGGAACAGCAAGAAGTGGAAAATACCCCCATGTATTTCTAACTGGNAANAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAANAGCAGGGTATGGACAGTGGCTTTG
  5   1   3        nb Gas7      in                         XZG24743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCAGCACCAGTAATGCATTCTCCCAGCAGAAAGATGACTGTAAAGGAACAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCT
  5   1   0       chi Gas7      in                         XZG34598.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCAAGAGTGGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGTGAACATTTCTGTTTGCTGCTAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCT
  3   1   3        nb Tad5      in                         XZT34226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAAATACCCCCATGTATTTCTAACTGGAAGAATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAG
  5   1   0       chi Gas7      in                         XZG41953.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTACTTATCATTCTTTTCAATAAATACATGACCAAATATAATTTGTTTCGTTTGTTTCCCTAGCTTTTCTTTATCTATTTTTTTTCTTCTATagatggtgttttaaggcacattcatataaaaatatagaagaatttaaagggttcacaaactttccagcacaactgtaATATACCAGTGTTCAATAACCAATGGGTTATGACTACTACAGTCCATTTTGTTTAGTATCCAGTGGAAGTAAAGAGGAATACTTTTATTTCATTCTCCCTCATATTAAAAAGGAGGGTAACCAGCTCCCAAATTTTATGCTGATTAACACACACCTTGGCCATTGTCTCATTGCTCTGTATAAAAAAATATATATATATGATTATTTATTTTTTCAGTCACAGGTGGTGCTCTCTAAATTTAGTGTATACAATTCCTTCCATGCTGGCATAAAAAGATATAATCCAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCC
  5   1   2       add Ski1      in                         CABJ5154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGCCAAGGGTTATACCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGA
  5   1   2       add Gas7      in                         XZG59278.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCACGCGTCCGCCATCCCACTAGATAAACGTTTGGCTGCTGATGGCCGGGGGCTGCAGACTGTCCATATCAATGAGAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAA
  5   1   3        nb BrSp                              EC2BBA9AH12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGCTGCAGAACTGTCCATATCAATGAGAAACTTTGCTAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGAATGGCGAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas138m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas       in                   TGas138m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCTTGCTGAAGCCTTGTACATAGCTGACAGAAAGGCCCGAGAAGCAGTGGAAATGAGAGCCCAGGTGGAGCGTAAGATGGCGCAGAAGGAGAAAGAGAAAAAGGAGGAAAAACTTAGGGAACTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTC
  5   1   2       ext Liv1      in                         CAAR4126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGCACAGATCGCAAGGGAACGCAGAGCTGGGATAAAGTCCCATACAGACAAAGAGGATGGAGAAGCCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCT
  5   1   3        nb Egg  FLt5 in                   TEgg077i06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGAGAGAGGGAAGAAATACGGCATGAGAGGCGCAAGGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTTCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAACAAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCA
  5   1   3        nb Tad5      in                         XZT22227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAACGGCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTNCAGGATCCAGTAGTTGTATGATATTTA
  5   1   3        nb Lun1      in                         CABD2911.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGGGCACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTTCAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGT
  5   1   3        nb Gas7      in                         XZG51569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAACATGAGCGAAACCTATCTAGGGCAGCCCCAGACAAAAGGTCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGTTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTNTCAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTG
  3   1   3        nb Gas       in                    TGas132k17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCCCCAGACAAAAGGTCCAACTTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTCAAAAAAAAAAAAAAAA
  3  -1   3        nb Egg       in                    TEgg019o16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCAAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGC
  5   1   3        nb Gas7      in                         XZG40249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACTTCAAAGGAATGAAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAGGGATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTG
  3   1   3        nb Neu       ?                     TNeu073m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAATGAAGAAAGAGACATTAGTGAACAGATGCTCTNGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATAAAAAGTAATTCAAAAAAAAAAAAAAAAAA
  5   1   2       add Gas7      in                         XZG16531.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGAC
  5   1   3        nb Gas7                                 XZG13937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAAGAGACATTAGTGAACAGATTGCTCTTGGAATTCCAAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTTCAAGGATCCAGTAGTTGTATG
  3   1   3        nb Fat1      in                         CABC5078.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAA
  3   1   2       ext Ovi1 5g3  in                        CABI12176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTANATTTC
  3   1   3        nb TbA  5g3  in                    TTbA013m14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Tad5                                 XZT32930.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAAAGGACATCAAGTGAAGTTCAGTATGACCAGCGACTTTTCACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTC
  3   1   3        nb Gas7      in                         XZG24743.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCAACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAAAAAAAAAAAAAGG
  3   1   3        nb Te5       in                         CAAO3663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAAT
  3   1   3        nb Te1  PIPE in                         CBWN5044.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGATTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAACTAATTAAAAAGTTAATTTCAAAATAAAAAAAAAAAAAAA
  5   1   0       chi In62                            IMAGE:8955305.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAAGCAGGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAGGATCAGTAGTGTATGATATTTACCTGGCACATTTAGTATAACAGAGCTGTACCTGCGCTGAAAGAATTTTGTGTACTGACTGCTGAATTCTTGAGTTACTACTCAAATATAAAGTATTCAAAATCATACTAGAGTTGACTATTTTCAGCTTTTAACGACTTGCAATGAACGCGTAGAATGACTGCAATCGAAGTGCATAATGCAATTGCTTGTCTCTTGAACGTAGCA
  5   1   3        nb Gas7      in                         XZG46723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATAGGGTATGGACAGTGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTT
  5   1   3        nb Tad5      in                         XZT13637.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTGGCTTTGCAGGTGGAGAGGAGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGC
  5   1   3        nb Gas       in                   TGas140m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGCTTTGCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAAAAACTGGCTCAAAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAAAACCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTC
  3   1   3        nb Gas5                                  XZF2010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTCAGGTGGAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTC
  5   1   3        nb Gas7      in                           XZG841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACGCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAANGAAGTAATTTCANAATATTCATACATAGTAGTTGTGATACATTATTTCTCCAGCTTTTTT
  3   1   3        nb Gas7 5g3  in                         XZG23590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATAT
  5   1   2       ext Neu       in                   TNeu119b11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGAGGTATATAACGTGTATGACAAGCCATGGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGA
  5   1   3        nb Gas7      in                         XZG34509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTGGGCAACAAGAAACTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAAATGTGCATTAAATATG
  5   1   3        nb Eye       in                         CCAX1955.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGCTCAGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGA
  5   1   3        nb Ova1      in                         CABE4108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAACATCTACCGTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATA
  5   1   3        nb Gas7      in                         XZG38803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCCTAGTAAAAATACAGATAATGATGTATATGGTGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTCCTGAAATGTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCC
  5   1   3        nb Gas                            TGas029l10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGATGACCTGGACACCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCATGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTGACTGTGTTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTGCTGCTGCTTCTTGCTAGAATCCA
  5   1   3        nb Gas       in                   TGas070f10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGCTTGGTTAAAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCCTGCTGAAATTCTTGGAGTATAAACACACT
  3   1   0       chi Gas7      in                         XZG16531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACCAACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAAAAAATAAAAAAAAAT
  5   1   3        nb Gas7                                  XZG6574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACAGGTTTGTTCCTGATAAGGACTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTACAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCCTGAATGTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAG
  5   1   2       ext Ski1      in                        CABJ11781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTTCTGGCGCAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAAATAGTTTTTCACTAAAGCAAGGGT
  5   1   3        nb Hrt1      in                        CAAQ11900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGATCGCAGGCAGCGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAG
  5   1   3        nb Egg                            TEgg084b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCCATGAAGGTCCAGTACAATTTGAGGAGGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCCAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCCACATTAATTAAAA
  5   1   3        nb Gas7                                 XZG56665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATCCTTTTGGTTTGGACAAGTTCTTGGAGGAGGCTAAACAGCATGGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTCCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGAATCCCTTGTG
  5   1   3        nb Gas8      in                           st9c20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGGTCAAAACGACCCTCCGATAGTGGTCGAGCTAAAGATCATGACCATGACATGAAGAAACGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTCCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGAATCCCTTGTGTGTTTGTCTGGAAGA
  3   1   3        nb Gas       in                    TGas081p12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAGCTAAAGATCATGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAAAAAAAAAAA
  5   1   3        nb Eye       in                         CCAX7554.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGACCATGACATGAAGAAGCGCAGGAAGGAGTGAGGTGGCACATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCA
  3   1   3        nb Brn4      in                        CAAL20404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTGTGTATTAATGGGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATNTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAAT
  5   1   3        nb Gas1                               IMAGE:6987165                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGACTGTTAATGACTGGGTTCAGGAGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCACCAAAGAAGGACTTTGCCCAACATCCCTGTATTCTTTATATA
  3   1   3        nb Gas7      in                         XZG46723.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTAGGAAGACTATATGTACATAATTGTTTTCATTTATTAAGTGTTTAGTCCAGTGGTTGTCTAGAATTTTGCTTACTTGCAAAAATTCTACTGCTGCAGGTAACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCAT
  3  -1   3        nb Lun1      in                         CABD9035.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTCTACTGCTGCGGTACTTTTTTTACACTGTAACTGTATTTTAGTCAAAAATCTGCGCCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGGTAGAGATAGGGACAGACATTAAACTTAAAAACATGC
  5   1   2       add Gas7      in                         XZG49365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCCGTCCGCAAAAATCTGCGCTTTTCCAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGCAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTCCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAAGTACGNCGCTGCGCTTCTCTGCATTTTTGGG
  5   1   3        nb Neu       in                   TNeu073n19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTAGTCAAAAATCTGCGCTTTTCCAAAACACTTATGCCAGTACTGCTGCTACTTGCTAGAATCCAGGATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTG
  5  -1   3        nb Egg                            TEgg098h12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATA
  5   1   3        nb Gas       in                   TGas055k19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATATTCTATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACT
  3   1   2       add Gas7      in                         XZG59278.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGTGGTCAAATGAAGACTCTTCAAGGAATCCAGTAGTTGTATGATATTTCCCTGGCCCATTTAGTAATAACAGGAGGCTGTCCCTGGCGCTGAGAGAATTTTGTGTAACTGACCCTGCTGAAATTCTTGGGGTATAACCCCCCTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCCCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTCCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGAATCCCTTGTGTGTTTTTCTGGAAGAGTGGCCCCTGCACCCTAATAACTCAATAACAAAATTAGTTTTTCCCTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACCCAATGTTTTCTGCACCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTCCTCCAATTTATGGGAAGGAAAAACAAAATAGGTCTGCTTTTTCCCTAAT
  5   1   2       add Gas                            TGas009c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAATCCAGTAGTTGTATGATATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCCTGCTGAAATTCTTGGAGTATAAACACACTCAAAACTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAAAATCCCTGTGTTTATATATACTACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTT
  5   1   3        nb Tad5                                 XZT19409.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTTACCTGGCACATTTAGTAATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAAGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACATGCTAT
  5   1   2       ext Neu       in                   TNeu084o12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAACAGGAGGCTGTACCTGGCGCTGAGAGAATTTTGTGTAACTGAGCCTGCTGAAATTCTTGGAGTATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTGACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGC
  3   1   3        nb Gas       in                    TGas055k19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCCTTTTGTATTACCCCCAGTTTAAGGCAGAATCCCCTTGTGTGTTGTTCTGGAAGAGTGGACCTNGCAGCTTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTAATTAAAAAAAAAAAAAAAAA
  5   1   3        nb Sto1      in                         CABG4205.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGNCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGNGTATATAGTTCCTCTTTACATCTTANATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGC
  5   1   3        nb Gas7                                 XZG12144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGNCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACA
  5   1   3        nb Tad5                                 XZT11163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACATACTCAAAATTAATTAAAAAGTTAATTTCAAAATATTCATACATAGTAGTTTTGATACATTATTTCTCCAGNCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGNGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATACTGTAGCTAA
  5   1   2       ext Gas7      in                         XZG34343.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTATTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACNAG
  5   1   3        nb Egg                            TEgg102d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCTCCAGCTTTTTTAACAGGTAACTTTGCAAAAAAGTGAAGCAGACGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCGATATTTGTCTATCTGGACATTTTCCTTTTGAATTACCCCAGTATAGGGCACAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACGAGGTTAGTTTTTCACTAGAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAGCATCCCTGTAGTCCTTTGTACTACTACAATTTATGAGAAGGAAAAACCAAATATGTCTGCTTTTTCCATAAT
  5   1   3        nb Gas8      in                         st112e20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACTTTGCAAAAAAGTGAAGCAGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTA
  5   1   3        nb Neu                            TNeu060n18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGGGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCGCGGGGTATATAGTTCCTCTTTACATCTTAAA
  5   1   2       ext Neu       in                   TNeu075o10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGGGTCGTTATGTAGTGTGAGCTGCAATATTTCTGAATGTTGCATTAAATATGCAATATTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACT
  3   1   0       chi Tbd0 5g3  in                       IMAGE:6977386                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTTTTTTTTTTGGAGAAAAAGAAAAGTTGGGAAACCCCCTTAGACCGAGGCCCTCTAAAATATAAACTCTCCAAATATAACGCAAAAGAAATTTTGGGTTTTTGTTTCCAACTAAAAAAGCCAAAGGGGGTGGGGAAGGGGTTAATTAACCCGTTTTTATTATTTTTTTGTTAGAATGACTGTTTGAAACCACAAATGTTTTTCTGGCAGCCCAAAGAAAAGGACTTTTGCCCCAAACCATCCCCTGTATTCCATTTATACTACTACAATTTATGGGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCCACCCATACAAATAAA
  5   1   3        nb Egg                            TEgg132d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTCTATCTGGACATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTG
  5   1   3        nb Ova1      in                         CABE9686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTCCTTTTGTATTACCCCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAANAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATA
  5   1   2       add Gas7      in                         XZG39469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACATTTTCCTTTTGTATTACCCCAGTTTAAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTTCTCTTTATATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCCATCAAAAGCAAATGTTGCATNCCTAAAACTGGCATAAAAAAAAGTATGTTTTCATATATAAAACTATA
  5   1   3        nb Te5       in                         CAAO5807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGTTTAAGGCAGAATCCCTTGTGTGTTTGTCTGGAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAA
  5  -1   2       add In63                            IMAGE:8960887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTGAATGACCCAGGTTAAGCAGATTGCTGGTGTTGTCTGAGAGTGAACCTGCAGCTTATAATTCATTACCAAATTAGTTTCATAAAGCAAGGTGAGGTATACGTTTATATTTTGTTAGATGACTGTTGACACAATGTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAAAATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCAATAATAAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATACAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAACTTTTTTTTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTTGTTCAGCTCAAAAAAAAAAAAGGAAATTTTTTTTTATTTATAGTTCTGAAGAAAAGA
  3   1   2       ext Liv1      in                         CAAR4126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGTGGACCCTGCAGCCTAATAACTCAATAACAAATTTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTAAAAAAAA
  3   1   4      seed Ski1 5g3  in                         CABJ3638.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGAGTGGACCCTGCAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAGCAAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   3        nb Te5       in                         CAAO5807.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGAGTGGACCCTGCAGCCTAATAACTCAATACAAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATAT
  3   1   2       ext Neu       in                    TNeu075o10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tad5      in                         XZT30837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCCTAATAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTTCTCTTTATATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAAC
  3   1   3        nb Gas       in                    TGas140m14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCCACCCATACCAATAAAATTTCTGTTCAGCTCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu073n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCCATACAATAAAATTTCTTTTCAGCTCTCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu057f02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATAAAGGTAGAAGTGTTTTTATTTTGTGTTTATTTAAATCCAGTTGAGGCCATACAATAAAATTTCTTGTTCAGCTGTCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu       in                   TNeu057f02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAATAACAAAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGATAGATGCTTTCTGCGCCCGGCGTATATATTTCCTCTTTACATCTTAAATT
  3   1   3        nb Tad5      in                         XZT30837.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTCATTAACAAAAATAGTTTTCACTAAAGCANGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTNTTCCATAATAAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTTCTCTTTATATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   2       ext Neu       in                    TNeu119b11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCCATACAATAAAATTTCTGTTCAGCTCTCAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ski1      in                        CABJ11781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTC
  5  -1   3        nb Lun1      in                         CABD9035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAG
  3   1   3        nb Sto1      in                         CABG4205.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTC
  3   1   3        nb Hrt1      in                        CAAQ11900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTTTTTCACTAAAGCAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTC
  3   1   0       chi HdA       out                  THdA008e17.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACAGAAACACAGTCCTCTTTTTAAAGAAGCCACCACAAGTTGCATAACAATCTGATGCCAGAAATGGTGCTGCATGCCAGATATTAGAGCACTGTACAACTGACTAGAATAAAGATGATTGTTTTTTTTTTAATGTTACGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTTTCAGCTCAAAAAAAAAAAAAAAAAAAGCG
  5  -1   3        nb Gas1                               IMAGE:6989721                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTGTTTTTCACTAAGCAGGGTGAGGTAATACCCGTTATATTTTGTAGATGACTGTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTAAACCACCATCAATAAT
  3   1   3        nb Neu                             TNeu102p15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGGGTGGAGGGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAANACATCCCCTGTATTCTTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAAGAGAACTAGTGTCGACGC
  3   1   2       add Brn3      in                         CAAK9058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCT
  3   1   3        nb Te4       in                         CAAN3918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTC
  3   1   3        nb Lun1      in                        CABD14066.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTCTC
  3   1   3        nb Lun1      in                         CABD2911.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   2       ext Ski1      in                         CABJ2597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACCGTTTATATTTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTC
  3   1   3        nb Gas7      in                         XZG25736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGTCCGATATTTTTGTAGATGACTGTTGACNACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGAAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTCAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas1      out                      IMAGE:6990114                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAGGGAATACGTAAATTTTGTGATGATGTGAACCACTTTCTTGCAGCCAAGAGGATTTTGCCCAAACTCCCTGTATCATTATACTACTTCAATAATGGAATGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCTGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGGTGCGATTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCTGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATTTACAGTTTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAGAGTGAACCAATCATGAGCAAAAGCTGATGCTTTAACCATCCAAAAGGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAAGCTATAGAAATCATGTATAGANAGTGTTTTTATCTATGTGTTTATTTAAATTTTTAAACCACCATACATGCAT
  3   1   2       ext Gas7      in                         XZG34343.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGTAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCT
  3   1   3        nb Tad5 5g3  in                         XZT51588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGATGACTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTTCTCTTTATATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTC
  5   1   3        nb Gas7      in                         XZG25736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGAAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGG
  5   1   3        nb Neu       in                   TNeu101h07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGT
  5   1   3        nb Gas7      in                         XZG53271.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAACACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAGGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTANAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGGTCAGCTCAAAAA
  3   1   3        nb Neu       in                    TNeu108h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTGTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATTTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACAGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTAAAAAAAAAAA
  5   1   3        nb Neu       in                   TNeu108h22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAG
  3   1   3        nb Te4       in                         CAAN6418.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   2       ext Hrt1 5g3  in                         CAAQ4711.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   3        nb Tad5      in                         XZT22227.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATGTTCTCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTTCTCTTTATATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas8      in                         st112e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGCAGCCAAAGAAGGACTTTTGCCCAAACATCCCNGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTG
  3   1   2       ext Neu       in                    TNeu084o12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTCTCCTTGCCCATGTCTGTTTGTATTTGCTGCTAGCCTTTTGTTCTGCTGAAGCCTGGAGCTGCAATATANAAAAAAAAGTGTTACCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Hrt1      in                         CAAQ2289.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTACTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTC
  5   1   3        nb Tad5      in                         XZT69039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCAAAGAAGGACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTTCTCTTTATATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCT
  5   1   3        nb Gas                            TGas007f03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACTTTTGCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCAT
  3   1   3        nb Eye       in                         CCAX1955.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCAAACATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCCCCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCCCCATACAATAAAATTTCTTGTTCAGCTCTCTC
  3   1   3        nb Sto1      in                         CABG9241.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  5   1   3        nb Sto1      in                         CABG9241.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG38803.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCTGTATTCATTTATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCT
  3   1   3        nb Thy1 5g3  in                        CBST4986.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATACTACTACAATTTATGAGAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTACTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   2       ext Tad5 5g3  in                          XZT9566.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCAATTTATGAGAAGGGAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGTCTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTTCTCTTTATATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCAAAAAAAAAA
  5   1   3        nb Brn3      ?                          CAAK3431.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTATGAGAAGGAAAAACAAAATATGTCTGGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCT
  3   1   3        nb Gas7      in                         XZG49876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                         XZG34509.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAGAAGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTCTCAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7 5g3  in                         XZG19381.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGAAAAAACAAAATATGTCTGCTTTTTCCATATAAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCNCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   3        nb Gas8      in                           st9c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGT
  3   1   3        nb Ova1      in                         CABE9686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTC
  3   1   3        nb Gas7      in                         XZG23393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   2       add Gas7      in                         XZG41953.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGTTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   3        nb Te4  5g3  in                         CAAN1690.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTACTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGC
  3   1   3        nb Ova1      in                         CABE4108.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTC
  3   1   3        nb Gas7      in                         XZG40249.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTTCTCTTTATATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCT
  3   1   3        nb Egg  FLt5 in                    TEgg077i06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCGGCCATACAATAAAATTTCTGTTCAGCTCTCAAAAAAAAAAAAAAAAAA
  3   1   2       add TbA       ?                     TTbA063a17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAACAAAATAGGTGGCTCTCTTCCATAATAAAAAAAAATGTGTACCGTTAGGATTAATTAAGCAGGGGGGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCAGGCGCAAGCAGGTTTGTATTTGCAGAGAGAGCAGAAGGGTTTTCAGTCAGAAAAAAGATGTTGGCGAGGTACGCGGCTGCGCTTTTTTGCATTTAAGGTTAGAGATAGGGACAGACATTAAAGTTAAACAATGCTCTAAGAGAGATGTTTTTTGCGCCCGGGGCATATAGTTCCTCTTTACTTCTTAAATTCAGAGCAGTATAGTGTAGAAGCACAATCAGGTCTTGGTTTTCATTTCACCCAGGCAGTGCATTTAAAAAACTGTAGAAAACAGGTCCTGAAAGCACCTCAATAATTCCAAGGAGCAAAAGGGAAATCCAACCCCTACATTTATTTACAGTTTGGGAGTAGCGAGGACCACAGGAGTTAAAGTTCAGTTGATATGGAAAAGTAAACCAACATGAGCAAAAGCTGGGGCTTTAACCATCCAAAAGCAAAGGGGGGGTTTTAAAACTGGCAATAAAAAAACCCCCCTTTTCTTATATAAAACTATAGA
  3   1   3        nb TbA  5g3  in                    TTbA072k09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAACAAAATAGGTTTGCTTTTTCCATAATAAAAAAAAATGTTTATTGTTAGGACTAATTAAGCAGCTGTGTTTAAAGAAGAATTATACCCCCGGGCACAAAAAGCATGCGCAACCAGGTTTGTTTTTCCAGAGAGAGCCGAAGTTTTTTCATTCAAAAAAATAATTTTGGGGAGGTACGGGGCTGCGTTTTTTTGCATTTTTGGTTAGGGATAGGGACAGCCATTAAATTTAAACAATGTTTTAAGAGAGATGCTTTTTGCCCCCGGGGTAAAAAGTTCCTCTTTACATTTTAAATTCAGAGCAGTATTGTTTAGAAGCCCAATCACTTTTGGGTTTTCAGTTCATTTATGCAGGGCATTTAAATAACTGTAGTTAACAGGGGCGGTAAGCCCCCCAATAATTGCAGGGGGCAAAAGGAAAATCCAATGCCTACATTTTTTTCCATTTTGTGAGTTGCCTGGGGCCCAGGAGTTAAAGTTCAGGTGATATAGAAAAGGGAACCAACATGAGCAAAAGGTGGTGCTTTAACCTTCCAAAAGCAAATGTGGCTTTTTAAAACGGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGGGTTTTTATTTGGGGTTTACTTAAATTTTTAAACCCCCATCCAAAAAAATTTTTTGTTCAGCTTTCAAAGGGGGGGGGGGGGG
  3   1   2       add Gas7      in                         XZG34598.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAAAATATGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTTTCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGCCATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCCCCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCCCCATACAATAAAATTTCTTGTTCAGCTC
  3   1   3        nb Gas7      in                         XZG51569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATTTGCAGAGAGAGCCGAAGTGTCTTCATTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTTTTTGCATTTTTGGTTAGAGATAGGGACAGCCATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGGGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCCCAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATTTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGGGTTTTTATTTTGGGTTTATTTAAATTTTTAAACCCCCATCCAATAAAATTTTTTGTTCAGCTCT
  3   1   3        nb Gas7      in                         XZG53271.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACAAAATAGGTCTGCTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAGGAGGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCGGCTC
  3   1   3        nb Gas       in                    TGas070f10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAAAATAGGTCTGTTTTTCCATAATAAAAAAAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATACAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAACTTTTTTTTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                         XZG49365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAAAAATGTTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTAGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTACACCACCATACAATAAAATT
  5   1   3        nb Gas7      in                         XZG13671.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTCTCAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                         XZG54298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCGGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTATTTAAATTTTTAAACCACCATACAATAAAATTTCTTGTTCAGCTCTCAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                           XZG841.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATGTTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCACAAAAAGCATGCGCAAGCAGGTTTGTATCTGCAGAGAGAGCCGAAGTGTCTTCAGTCAGAAAGATGATGTCGGCGAGGTACGCGGCTGCGCTTCTCTGCATTTTTGGTTAGAGATAGGGACAGACATTAAACTTAAACAATGCTATAAGAGAGATGCTTTTTGCGCCCGGGGTATATAGTTCCTCTTTACATCTTAAATTCAGAGCAGTATTGTCTAGAAGCACAATCACTTCTTGGTTTTCAGTTCATTTATGCAGTGCATTTAAATAACTGTAGCTAACAGGTGCTGTAAGCACCTCAATAATTGCATGGAGCAAAAGGTAAATCCAATGCCTACATTTATCTACAGTCTGTGAGTTGCCTGGTGCACAGGAGTTAAAGTTCAGGTGATATAGAAAAGTGAACCAACATGAGCAAAAGCTGCTGCTTTAACCATCCAAAAGCAAATGTTGCATCTTAAAACTGGCAATAAAAAAAAGTTATGTTTTCATATATAAAACTATAGAATCATGTATAGAAGTGTTTTTATTTTGTGTTTACTTAAATTTTTAAACCACCATACAATAAAATTTC
  5   1   3        nb Neu       in                   TNeu066g24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTACTGTTACGACTAATTAAGCAGCTGTGCTTAAAGAAGAACTATACCCCCGGGCAC