Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABK3723.3                           91 END     1           1        1                Unknown (protein for IMAGE:7608031) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABI14240.3                          78 END     1           1        1                LOC495701 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 90%

 1012070867 Xt7.1-XZG50685.5 - 95 ESTs
                                                                       ..-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG50685.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTTTTTCGGTTTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAATTACTAAAAAAAAAAAAACTGTTTGTCCAT
                                                  Xt7.1-CHK-1008223376                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCGGTTTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAAxxAxxAAAAAAAAAAAAAxxxxxxGTCCATTCATGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          4     5     7     8     7     9     7    10     9    12    10    13    11    14    13    16    15    21    18    24    22    27    34    41    35    41    40    42    43    47    43    49    49    51    50    53    51    53    51    55    51    55    51    55    51    55    50    55    51    56    61    65    60    68    69    74    73    77    74    79    75    80    77    81    74    81    77    81    77    81    71    81    76    82    77    83    77    83    79    83    78    83    76    83    73    84    76    85    77    86    73    85    75    85    71    84    74    84    74    84    72    85    73    84    77    87    77    87    74    85    75    85    72    85    72    85    75    85    74    82    67    78    67    74    67    74    64    74    65    74    66    74    61    69    63    70    61    67    57    65    57    63    56    62    54    59    51    58    48    55    43    54    36    50    32    42    25    35    24    35     5    17     7    11     2     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------G-T-
                                               BLH ATG     239     467                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN     116      69                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR     239      62                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               EST CLI     123      32                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG     239       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 3e-014     NP_499538.2 TBP-Associated transcription Factor family member (38.2 kD) (taf-12)[Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sc ---- 3e-025     NP_010429.1 TFIID subunit (TBP-associated factor) with predicted molecular weight of 61 kD.;Taf12p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 3e-038     NP_524320.1 TBP-associated factor 12 CG17358-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 8e-044     XP_788876.2 PREDICTED: similar to TAF15 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 1e-057     NP_938182.1 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor [Daniorerio] ================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 1e-066     NP_079855.1 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor; TAF12RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20 kDa [Musmusculus] =============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 1e-067     NP_005635.1 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kD; transcription initiation factor TFIID 20/15 kDa subunits; TATA box bindingprotein (TBP)-associated factor, RNA polymerase II, J, 20kD [Homo sapiens] =================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 2e-069     NP_001026065.1 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20 kD [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 1e-085     BAA09789.1 TFIID subunit p22 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 1e-085     NP_001081155.1 TAF12 RNA polymerase II, TATA box binding protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Xt ==== 7e-091     NP_001016168.1 hypothetical protein LOC548922 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG50685.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA------------------TAA---------------------------------------------------ATGTAA------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------TAA------------------------------------------TGA---TGA---------------------------TGA---TGA------------------------TAA------------------------------------------------------------------------------------------TAA------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Neu  FL                     TNeu073d04.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAAAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Gas       in                    TGas117h05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTTTTTTTTTTTTGTTTAGGTCGGCGTATTGGGAGCCATGGTTTTTCGGTTTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCANATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGT
  5   1   2       bld In60 5x3                        IMAGE:8951527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTTTATATTGAATAGTGCAGTCTTAACATAAAAATAGTCTTTTGGTTTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAATGGCTTGTACTACTGAAGCACATAACAGAGATGGCTTTAATTTAGAAACACAAAGAAATAAATCCATTTGTGACTTTGGACTTCTGCATTCCTTGCATTCTGATCTGAAACTCACTGCCACAGATGACGGATGAGCGGGAAGGCCACCCTCTTTCAGAAGAAAAGATCCTTACTCTTTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG59780.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCGTATTGGGAGCCATGTTTTTCGGTTTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAA
  5   1   2   12  bld Gas7 5g3  in                         XZG15983.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTGGGAGCCATGTTTTTCGGTTTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCANATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAA
  5   1   2       bld Gas  5x3  out                  TGas141e04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGGAGCCATGTTTTTCGGTTTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAG
  5   1   2   10  bld Ova1 5g3  in                         CABE2414.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCA
  5   1   2   10  bld Ova1 5g3  in                         CABE9456.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTCTGCGCATATTCTGAGTTTTGGATTGTTCCCGTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTNCAACTGCCACAGATGACAGATGAGCGTGAAAGGCACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTAC
  5   1   2   32  bld Gas7 5g                              XZG12995.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATGTGTGATGTAACGTCCGCCAACANGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGAAGGCCGGTGATGATGACGTGTGTGCTCAGCGGTTCCACCGCCGTGTGCGATGTCATTACAGAGCTAGATACTCAACTGGCTCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGATGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTTCTGCATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAG
  5   1   2   10  bld Bone 5g3  in                         CBTC587.fwd .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGAAGGCCGGTGATGATGACGTGTGTGCTCAGCGGTTCCACCGCCGTGTGCGATGTCATTACAGAGCTAGATACTCAACTGGCTCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAA
  3  -1   2       bld Ova1      in                         CABE8148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATTGTTCCCGTTAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTG
  3   1   2       bld Tad0 5g3  in                       IMAGE:6982255                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTTTAGGGTGACCCATAATAGAACCAAAGTTTGTTACAAAAAAAGCAGGGTTGGTACCCGGTCCGGGATTTCCCCGGGATCAGAACTTAAAAGCGCAGAGATTGCTTTNTAGGCCTGGGGCCCCCATACCCCAAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATGGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCNTCCTTTACAACCACCACCACCACTCCTACNTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGAT
  5   1   2   12  bld Gas7 PIPE in                         XZG38500.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTAAATAAAGTGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTT
  5   1   2       bld Gas8 5g3  in                         st116a23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTGGGGGGGAAGAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGGTAAGATTTCCAAAGCTGTATGAAAGAAACTAGCTTCTTCCTAGAATTCTCTTCTGAATATCGCTGACCTGCCTCTGTCCAGGATTTGGAGGATGGCAGGCACTCCGGGACTTGAGAGGGTATCGAGCAGTATCTCGGGAAATGCAGTAAAATGAAAAAAATGTGTTTGTATTGGCACATAGTGCTGCATGGCCTTGCGCATTTCGTGCCATCATGGTA
  5   1   2   12  bld Gas7 5g3  in                         XZG15884.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGAATTTGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAG
  5   1   2       bld BrSp 5g3  in                     EC2BBA17BH01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAGACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAA
  5   1   2       bld HeRe 5g3  in                     EC2CAA12DD01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCGCATGAGCGGAAAGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAA
  5   1   2       bld Egg0      in                         dad71c09.y2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGCCCGGGGNAAGCTGTGTNGAGTAACGTCCGCCACACCCAAGATACACANACTCAAACGCANAGATGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTGAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAAGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGGGGAACATGGGGATTCCAGGCTTTGGTTCAGAAAAAATTCGGCCCTATAAAAAGGCTTGGACTACTGAAACACATAAACAG
  5   1   2   32  bld Gas7 5g                              XZG50685.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGANAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTTATTAAACATGGCTGATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld HeRe 5g3  in                     EC2CAA30AH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATGTGTGATGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACGGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTT
  3   1   2       bld Ova1 5g3  in                         CABE9456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGTGTGATGTAACGTCCGCCANCAGGGAGAGAGACAGCAGAACTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTTTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  5   1   2       bld Gas  5g                        TGas045e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTGATGTAACGNTCCGCCAACAGGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAA
  5   1   2       bld HeRe 5g3  in                     EC2CAA39AE03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACT
  5   1   2       bld HeRe 5g3  in                     EC2CAA39AF02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTAACGTCCGCCAACAGGGAGAGAGACAGCACAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAGAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACATAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGA
  5   1   2       bld HeRe 5g3  in                     EC2CAA39BE02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTAACGTCCGCCAACAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCT
  5   1   2       bld TpA  5g                        TTpA055j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGGAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCG
  3   1   2       bld BrSp 5g3  in                      EC2BBA8BH09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAACACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTGGGGACAGAAAGTTTACAACCCACTTGCGGGAAAGGGTTAA
  5   1   2       bld BrSp 5g3  in                      EC2BBA8BH09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAACACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGT
  5   1   2       bld 1030 5x3                        IMAGE:7030331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACATAAACAGAGAATGGGTTTTAATTAAGAAAACNNCAAAGGAATTAAAATCCATTTTGTGGACTTGGGACTTTCTGCAATCCCTTTGCCATTTCTGATCTTTGACACCTTCAAACTGGCCACCGATGGACANAATGACCGTGGAAGGCCAACCTTCTTCAAAAGAAGAGTCTAACTTTTGGGGGAAANGAAAGTTTAACAACCCTCTTGTGCTGGGAAAAGGGGTTATTT
  5   1   2       bld Neu  5g                        TNeu082k23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTGCTACTGAAGCACATAAACAGAGAATGGCTTTAATTA
  5   1   2      seed TpA  5g3  in                   TTpA041p19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGACAGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATG
  3   1   2       bld Tad0 5g3  in                       IMAGE:6982231                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCGAAGTAAAGGCGCTGAGATTGCTTGTAGAACCCTGGCGCCCATCCCCCATAAACAGCGTGCTGACGTATCCCGACCGGGTGAATTGCGAGCAATAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTGTCGTTCCTNTTACAACCACCACCACCACTCTTACATCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGG
  5   1   2   10  bld Spl2 5g3  in                       CBSS10633.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGAC
  5   1   2   12  bld Tad5 5g3  in                         XZT43952.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATG
  5   1   2   10  bld Tbd1 5g3  in                        CBXT10611.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAATCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTG
  5  -1   2       bld Gas       in                   TGas117h05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAACTTAAAGCGCAGAGATTCTTTTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTTTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Neu  FL   in                   TNeu073d04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTGATTGAGAGTGTGGGATC
  5   1   2       bld Neu  5g3  in                   TNeu109i20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACA
  5   1   2       bld Tad0 5g3  in                       IMAGE:6982231                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCGTTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCGAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAGAGGCTTGTACTACTGAAGCACAGAAACAGAGAATGGCTTTAATTGACAAGACACAGCAGAGATAAAATCCATTTGTGACTTTGGACTTCTGCAGTCCCTTGCCATTCTGATCTTGACACCTTCAGACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGATAGTTTACAACCCTCATGCTAGGAAAAGCGTGATATGGTCCCCTGGACTAACCTTTTGTCTATACATCCGGAATTGTTTGTTGTAATTAAACATGGCCTGATGGTACAGGGAAGAATGTAATGTTGGTGGCTTTAAAANCNTGGGGGGACGGCTGCTTCCCAAAATAAACCCCTCCGAAGGGGGCCCCAACCCTTAAGCCCTTACCCCAGGGTATTCGT
  5   1   2       bld Tad0 5g3  in                       IMAGE:6982255                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGGTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGGATTTGTTTGTTTAAATTAAACATGGGCTGAAATGTN
  5   1   2       bld HdA  5g3  in                   THdA041m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGGGTAATTGGTCCCCTGACTACCTTTTGT
  5   1   2       chi Tad5                                 XZT11340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAACTTAAAGCGCAGAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAAAAAAAAAAAAAAAAGG
  5   1   2   10  bld Tbd1 5g3  in                         CBXT9981.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGATTGCTTCTAGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGTTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGT
  5   1   2       bld TpA  5g                        TTpA055j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTAGGCCCTGGGCCCCATCCCCAAGACGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAGCCACAACCACCACTCCTACCTCAGTCGCGGTCGAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTGAGAAGAAACTGCGTGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAGATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAGATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTA
  3   1   2       bld Ova1 5g3  in                         CABE2414.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  5  -1   2       bld Ova1      in                         CABE8148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGCCCTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  5   1   2   10  bld Tbd1 5g3  in                        CBXT11302.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGGCCCCATACCCCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTAC
  5  -1   2       bld Int1      in                        CAAP14591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGGGTTATAATGGTGTACCCAAGCCTTTGTGGGGGTTTTTTAATTTATTTATTTATTAATTTTTTGTTGCTACCTTTGTTTTAATTTGCACAATGTTGCATTTTTACTTGCAAAGAACAAAAAAAGGCCAATCTGGGGGATGCAAAATTTTAAGTTGACTTCCCGATGACCACAGCCTGCTTACCTTGAATTCCAGGACAGTGTCCCTCTTCCTTTAAAAACATGGTGTTATGGTGCTGATATTTTTTAGAGGTGCAGTGGCTTCATCTCAGCTGCTCTTTCACGTGTTCAGCATTTGCCTGCCGTTGCCCAGGTTCGGCACATACACATTGCAACTAGCCATTGGTGCCATATTGAACACCTGGGAGAGCAGGCAAGGTGGGGCTGGCATACCTCTAAAGAACAATATCAGTGTCAGCATTTTCATTTTAATTTAACTTTAATTAAACTAGTTTTTTTTTTTTTTTTCAAATCAAATTGTTTTGTCTGTTTATGTTTACCTGCCTACTTACCATCCCCTCTGTTTTTCTAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCATTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAA
  3   1   2       bld Ova1 5g3  in                        CABE10678.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  5   1   2       bld Ova1 5g3  in                        CABE10678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAACAGCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Liv1      in                        CAAR11638.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTG
  5  -1   2       bld Liv1      in                        CAAR11638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGTGCTGACGTATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGNGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTG
  3   1   2       bld BrSp 5g3  in                     EC2BBA17BH01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATCCCGACTGGGTGAATTGCGAGCAAAAGCGCTCCAGATTATGAACCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAGACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAG
  3   1   2       bld Tbd1 5g3  in                        CBXT10611.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGACTGGGTGGAATTGCGAGCAAAAGCGCTCCAGATTATGAATCAGTTTGGAGCATCCGCATTGATCAACCTGTCAAGTTTCTCCTCCTCTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAATTACTATTAAAAAAAAAAAAAAAAA
  5   1   2       chi Sto1      in                         CABG2247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGCCNCTGTTTAACAAAAAACATTGATCTTTCATGATTAAAACATTAGGCGAAAAGTATGTTCATTGCAAGCTCTATTTATTATGCTCTTGTTGAATGGGAGTATACTGGCCCTTTAATAATAACATTAATAATGTTTTTATCTAAATTACAATGTCACCTGCTGGTGCAGCTTAAGAATTACACCACTTATAAATCAGATTCAGAGTACAAAAAAAAGTACAGTGTTATGATTGTTTTTTCTTTCCTTATTTTTTTCTCCCTCCTCCCTTATTATGATAATGTTAAATAGAGAGAGCCTTCCTTCTTGATTATTAAGTATATGACACGGGCATCAGATGTAAAACCAAGCATACAAGTCTGAGATGTTGAATTTCTGCTCCTATTTACACAGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                         CABG2247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCCCTGTTTACAAAAAAACATTGATCTTTCATGATTAAAACATTAGGCGAAAAGTATGTTCATTGCAAGCTCTATTTATTATGCTCTTGTTGAATGGGAGTATACTGGCCCTTTAATAATAACATTAATAATGTTTTTATCTAAATTACAATGTCACCTGCTGGTGCAGCTTAAGAATTACACCACTTATAAATCAGATTCAGAGTACAAAAAAAAGTACAGTGTTATGATTGTTTTTTCTTTCCTTATTTTTTTCTCCCTCCTCCCTTATTATGATAATGTTAAATAGAGAGAGCCTTCCTTCTTGATTATTAAGTATATGACACGGGCATCAGATGTAAAACCAAGCATACAAGTCTGAGATGTTGAATTTCTGCTCCTATTTACACAGAGCGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  3   1   2       bld Gas7 5g3  in                         XZG59780.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCTACAACCACCACCACCACTCCTACTTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGAT
  3   1   2       bld Tbd1 5g3  in                         CBXT9981.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAA
  3   1   2       bld HeRe                             EC2CAA37BE06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACAACCACCACCACCACTCCTACTTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTG
  3   1   2       bld Gas8      in                          st40j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTT
  3   1   2       bld Gas8      in                          st41j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAACCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGAC
  3   1   2       bld Tad5 5g3  in                         XZT43952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACCACCACCACCATTCCTACTTCAGTTGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTTTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTTTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATTTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCTTCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACCCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTTTGCAATCCCTTGCCATTTTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  3   1   2       bld HeRe 5g3  in                     EC2CAA39AF02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACCACCACCACTCCTACTTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTTATACATAGGATGTTT
  5   1   2       bld Gas8      in                          st40j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  3   1   2       bld Neu  FL   in                    TNeu073d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCACCACCACTCCTACCTCAGTNGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGAGTAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                          st41j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAAAAAAAAAA
  3   1   2       bld Gas       ?                     TGas141c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACCACCACTCCTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATNTGTTTGTTTAATTAAACCATGGCTGATGTANAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA12DD01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACCACTCCTACTTCAGTCGCGGTCAAACAGGAGCCGGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCACTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGAGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCGGA
  3  -1   2       bld Int1      in                        CAAP14591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGGTAAGATTTCCAAAGCTGTATGAAAGAAACTAGCTTCTTCCTAGAATTCTCTTCTGAATATCGCTGACCTGCCATCTTCTAAATTTTGGATTTCCTTATGGCCCCCTCAAGCTGAAGGTCTGGGGCGTGAGCACCCAGGCCCATCTATACCATCGGTGAGCATTCAACCAATATTTGACTTTAAGAGCATAGTTTCCATTTGTGTTTATCTTGCTCTGTCCACATAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCANATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCC
  3   1   2       bld Gas7 PIPE in                         XZG38500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACNTCAGTGGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATTTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACCCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTTTGCAATCCCTTGCCATTTTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAATTACTATTT
  3   1   2       bld Bone 5g3  in                         CBTC587.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTTTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  3   1   2       bld Spl2 5g3  in                       CBSS10633.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTCAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAATT
  3   1   2       bld Neu  5g3  in                    TNeu109i20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACCATGGCTGATGTAATTACTANAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA30AH06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTCGCGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATGT
  3   1   2       bld HeRe 5g3  in                     EC2CAA39AE03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTATTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTTATACATAGG
  3   1   2       bld HdA  5g3  in                    THdA041m08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGTCAAACAGGAGCCAGTCATGGCAAACAGTATTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGGGGGGGGGGGGCAAGTCCAGATGCAAATCAGGTTTTTTTTAAGAAGAAAATGCATGATTTGGTTAGGGAAGTTGATCCCAATAAACAGCTGGATGAAAATGTGGGGGAGATGTTTTTACAAATCGCAGAGGATTTCTTTGGGAGGGGGGTTTTTGCAGCCTGCCAGTTTGCCCGACCCCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGTTTTTTTTTGAGAGACAGGGGAACATGGGGATTCCAGGCTTTGGTTCAGAAAAAATTTGGCCCTATAAAAAGGGTTGTATTATTGAAGCACATAAACAGGGAATGGTTTTAATTAAGAAAACCCAAAAGAAATAAAATCCCTTTGGGACTTTGGATTTTTGCAATCCCTTGCCATTTTGATTTTGACCCCTTCAAAATGCCCCAGATGACAGATGGGGGGGAAGGCAACCTTTTTAGAGAAGGGTTTAATTTTGGGGACAGAAAGTTTACAACCCTTTTGTTGGGAAAGGGTTAATTGGTCCCCCGACTCCCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACCAGGGGGGGGGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGCG
  3   1   2       bld TpA  5g3  in                    TTpA041p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTTTTATTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTTTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATTTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTATTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTTTGCAATCCCTTGCCATTTTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTCCCTTTTGTATATACATAGAGATTGTTTGTTTAATTAAACCATGGCTGAGGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Gas7 5g3  in                         XZG15983.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAAACAGGAGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGAGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  5   1   2       bld Gas                            TGas029n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCCAGTCATGGCAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  3   1   2       bld TpA                            TTpA075f01.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAGTCATGGCAAACAGTACTCCAGTGGTAAAGTTCCAGTGCCAACTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAAGGGTTAAATTGGTCCCCCTGACTACCTTTTGTATATACATAAAGATTGTTTGTTTAATTAAACCATGGCTGA
  3   1   2       bld Gas7 5g3  in                         XZG15884.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAACAGTACTCCAGTTGGTAAAGTTCCAGTGCCAATTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  3   1   2       bld HeRe 5g3  in                     EC2CAA39BE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAGTACTCCAGTTGGTAAAGTTTCCAGTGCCAATTGCTGGAGGAGGGCGTGCAAGTCCAGATGCAAATCAGGTTCTTACTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTTATATACATAG
  3   1   2       bld Egg0      in                         dad71c09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGTTCCAGTGCCACTGCTGGAAGGAGGGCGTGCAAGTCCAAATGCAAATCAGGTTCTTATTAAGAAGAAACTGCATGATTTGGTTAGAGAAGTTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTNTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGA
  3   1   2       bld TbA       in                    TTbA046a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAGAAAATGCATGATTGGGTTAGAGAAGGTGATGCCAATGAACAGCTGGATGAAGAAGTGGAGGAGATGTTTTTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATTTGCAGCGGGCCAGGTTGGGGGGCACAGCAAATCCAACACTTTAGAAGTTAAGGAGGTACAGGTTCATATTGAGAGAAAGTGGAACAAGAGGATTTCAGGAGAAGGTTCAGAAGAAATTAGGCCCTATAAAAAGGCTTGTAATATTGAAGCACATAAACAGAGAAAGGGTTTAAT
  3   1   2       bld Gas8 5g3  in                         st116a23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACTGCATGATTGGNTAGAGAAGNTGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGGTAAGATTTCCAAAGCTGTATGAAAGAAACTAGCTTCTTCCTAGAATTCTCTTCTGAATATCGCTGACCTGCCTCTGTCCAGGATTTGGAGGATGGCAGGCACTCCGGGACTTGAGAGGGTATCGAGCAGTATCTCGGGAAATGCAGTAAAATGAAAAAAATGTGTTTGTATTGGCACATAGTGCTGCATGGCCTTGCGCATTTCGTGCCATCATGGTACTTAATCATAGGCTAAATAAAAAGACACAAATGACAAGTATCTATCTATGCTACTGACACATCAGTAGCTGGACATTTTCATGAATGTTCAAATAGATCATTATCCCATCTTTCTGTTGTAGGCATAGATAGAGCCTTTCCTTGTCCTAGAGGAGGTAATATTGTTAATGCTCTTATTAAAAAAGAAACCAAATGGATCTTTTACCTTTATACACGACAACCAAATGGTCTAAATTATGACTACGATGTATCTTGTTATGTGTAATTAATCCATTTATTATCCTTTTATGAAGTAAGCTCTTCATTAACAGACAATGAGAAATTAGTAATAGAAAGGTTAAACTTTTATTGCATCTACATTATAAGGTGACATGATGTTAAAAATGTGACAATAAGAAGGCTCAAACCAATGTAAAAAACTGCAAATG
  5   1   2       bld Neu                            TNeu035j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGT
  3   1   2       bld HeRe                             EC2CAA39AE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGATCGCAGATGATTTCATTGAGAGTGTGGTATATGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATA
  3   1   2       bld Gas0                                 dad21e07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTTTGAGAGTGTGGTATTTGCAGCTTGCAAGTTTGCCCGACACCCGCAAATCCAACCTTTTAGAAGTTAAGAATGTCCAGTTTCATCTTTAAAGACAGTTGGAACATTGGAATTCAGGGCTTTGGTCCAAAAAAAATTCGGCCCTATAAAAAGGCTTGTATTACTGAAGCCCATAAACAGAGAATGGCTTTAATTAAGAAACCCCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGAAAATAAACAGAAAAAAA
  5  -1   0       add TpA       out                  TTpA006a10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGCCCCCTCAAGCTGAAGGTCTGGGGCGTGAGCACCCAGGCCCATCTATACCATCGGTGAGCATTCAACCAATATTTGACTTTAAGAGCATAGTTTCCATTTGTGTTTATCTTGCTCTGTCCACATAGATGCTTCTACAGATCGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCCAACACTTTAGAAGTTAAGGATGTACAGCTTCATCTTGGTATGTTAACCATAACCATATGATGCCAACTTTGTATTTTGTTTAATTCTGCTGTCCCACTTGGATAAGATACACATGAGCAGCTTTTTCTCAATATGTATAAAAACCCTGTCATGAGCTAAGATGAATCTGTGCAAAAGTGGGATTAAATCAATATAAAAGTCAGCAAAAACACATCACACATCACACTTTCCTAAATAAATATTAGTGAAGATTTTCTGTGTATTAGTGTGCATGCACTGGCACAAGGGATCCTTGGGTAAAGGCAGGAGTCCATTATTCAGAGGGGTTGTATGTGTACTAGTAATTCAATTATCTACCTCAAAAGACTAAACATGGAGTAGTTTAAATTTCCCTGTTTGCCCTGTTTAACAAAAAACATTGATCTTTCATGATTAAAACATTAGGCGAAAAGTATGTTCATTGCAAGCTCTATTTATTATGCTATTATTAAAGGGCGCAGTATACTCCCATTCAACAAGAGCATAATAAATAGAGATGGCAATGAACATTAGGCGAAAAGTAGTT
  3  -1   2       bld Tbd1      in                         CBXT5811.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTTCAAATCAAATTGTTTTGTCTGTTTATGTTTACCTGCCTACTTACCATCTCCTCTGTTTTTCTAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAATTACTATTTCTACTGATTCTGTTTGTCCATTCATGGAAACAGTCCAGGTAAAAGTGAAGAGTGTTAAAGTGCTGATGGCATCAGTTCTGTCAAACTCCGGCAGTGAGATTAATACCAAAACTGCCATTAACAGGCACAATCACTCTCTGTTTTTTTTTTTTTTTTGGTTTTTTTTTCAACATGTGCATTTTGCTTCTTGGTTTTTCTGCATTTCTTTGTTTGTACAATAGGCCCCACTACTGTCATCTGTTGATACCTGGGCCTGCGAACGAGCAGCTCTAAGCAGTTCCCTGCACAAAAGTGAAAGTGCAGCAGACACATTGCTCCCTGTTCGGGCAGAGGTCTCTAAATAAGGAGCACTAAGATTTTCTGCTAGTCTCTGGGCCTCCTCCCGGGTTACCATTCGCTTCT
  3   1   2       bld HeRe      in                     EC2CAA29CG08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTTATATACATAGGAT
  5   1   2       bld HeRe      in                     EC2CAA29CG08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAACATGTGGATTCCAGGCTTTGGTTCAGAAGAAATTCGGCCCTATAAAAAGGCTTGTACTACTGAAGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTTTAATTAAACATGGCTGATGTAATTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe                             EC2CAA39CE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCACATAAACAGAGAATGGCTTTAATTAAGAAAACACAAAAGAAATAAAATCCATTTGTGACTTAGGACTTCTGCAATCCCTTGCCATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCTGGGAAAGGGTTAAT
  5   1   2       bld TbA       in                   TTbA046a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTCTGATCTTGACACCTTCAAACTGCCACAGATGACAGATGAGCGTGAAGGCAACCTCTTCATAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTTGCT
  3   1   2       bld Tbd1 5g3  in                        CBXT11302.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTGAAGGCAACCTTTTCAGAGAAGAGTCTAACTTTGGGGACAGAAAGTTTACAACCCTCTGGGGGGGAAAGGGTTAATTGGTCCCCTGACTACCTTTTGTA
  5  -1   0       add Tbd1      in                         CBXT5811.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGTAATTACTATTTCTACTGATTCTGTTTGTCCATTCATGGAAACAGTCCAGGTAAAAGTGAAGAGTGTTAAAGTGCTGATGGCATCAGTTCTGTCAAACTCCGGCAGTGAGATTAATACCAAAACTGCCATTAACAGGCACAATCACTCTCTGTTTTTTTTTTTTTTTTGGTTTTTTTTTCAACATGTGCATTTTGCTTCTTGGTTTTTCTGCATTTCTTTGTTTGTACAATAGGCCCCACTACTGTCATCTGTTGATACCTGGGCCTGCGAACGAGCAGCTCTAAGCAGTTCCCTGCACAAAAGTGAAAGTGCAGCAGACACATTGCTCCCTGTTCGGGCAGAGGTCTCTAAATAAGGAGCACTAAGATTTTCTGCTAGTCTCTGGGCCTCCTCCCGGGTTACCATTCGCTTCTCCTTCAGGTCATTCTTTGCTCCAAGCAGCATGAACACCATTGGTTTGGCTTGAGTCCGCTCAGTTACCTCCATATGCCATTCAGTGACATTATCAAAAGATTGCCGTGTGGTAAGATCAAAGAGAAGGAGAACCCCGGCAGCATTTCTGTAGTAGGAACGTGTCACAGCTCTATATCGCTCTTGCCCTGCCGTGTCCCAGAACTGCAGTCTGACTTTTACACCAGGCTCTGGCTCCTCTTCCCGGCAGCAGAAATCAACTCCTACTGTCTCTGTTGTTGTGTCTGTAAATTGGCCATCCGTGTAACGATGGAGTAGAGAAGTCTTACCCACTCCTGAGTCTCCCAACAGAAGTACACGGAACTGAAAATCCCAAGCACATGCCATGCTCAGACAAGAAATGGGATCTGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)