Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012070889 Xt7.1-TGas132d18.3.5 - 173 ESTs
                                                                       .........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas132d18.3.5                    AGTTATTTTGGTGTGTGTGTGTGTGTGTGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCACAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222075                          TTTGGTGTGTGTGTGTGTGTGTGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCxxxTCxCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGxGTGxGxGAxAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAAAAAGGAAA
                                                      consensus depths                         3     3     3     3     3     3     3     4     3     4     6     7     6     7     6     8     6     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8    15    11    17    18    21    18    21    18    22    18    22    18    24    18    24    18    24    18    24    18    24    18    24    18    24    18    24    18    24    18    24    18    24    18    24    18    25    18    25    18    25    18    25    18    25    18    25    18    26    19    27    19    27    18    26    18    26    19    27    18    26    18    26    17    25    18    26    18    26    18    26    18    26    17    25    15    24    13    23    13    23    12    22    12    22    12    22    10    19    10    19    10    19    10    19    10    19    10    19    10    20     9    19     8    18     9    18     9    15     9    14     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     8    11     8    11     8    11     8    11     8    11     7    10     6    10     6    10     4     8     3     7     3     7     4     8     4     8     4     8     4     8     5     9     5     9     5     9     5     9     5     9     5     9     5     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     8     6     8     7    10     7    10     7    10     7    11     7    11     9    12     9    12    10    12    10    12    10    12    10    11    10    11    10    11    10    11    11    12    12    13    12    13    11    12    10    11    10    11    10    11    10    11    10    11    10    12    10    12    12    13    12    13    12    13    12    13    12    13    13    14    13    14    14    15    15    16    16    17    16    17    15    17    16    17    17    18    18    19    18    19    17    18    18    19    19    20    19    20    19    20    19    20    18    20    20    21    21    22    21    22    22    24    23    25    23    25    24    25    24    26    24    26    24    26    25    30    25    30    26    31    26    32    26    32    26    32    27    32    26    32    26    32    26    32    26    32    27    33    27    33    28    33    27    33    27    33    29    32    21    32    21    32    21    32    22    31    21    29    21    29    21    29    21    29    21    29    21    29    20    28    20    28    20    28    19    27    19    27    19    27    20    28    20    28    20    28    20    29    19    28    18    27    18    27    18    27    18    27    18    28    19    29    18    28    18    27    18    28    20    30    19    30    19    29    20    29    19    28    19    27    19    26    19    26    19    26    19    24    19    24    17    28    21    28    16    29    17    30    17    30    18    31    17    31    17    31    17    31    19    32    20    32    20    32    22    33    22    36    25    38    26    41    36    48    38    48    39    50    43    55    43    57    43    58    44    59    44    59    47    63    48    68    51    69    70    70    51    71    51    73    53    75    53    76    56    78    56    79    55    79    54    78    55    79    53    78    55    79    56    80    56    81    56    81    56    81    59    84    60    85    61    90    60    90    58    89    60    89    59    89    59    89    57    89    54    85    57    81    57    80    57    80    73    80    57    79    56    78    56    78    55    78    56    78    53    78    57    79    54    74    54    74    53    74    53    74    54    74    54    74    51    72    52    72    51    72    52    72    52    72    52    72    52    72    51    72    52    72    52    72    52    72    51    71    52    72    51    71    45    68    45    68    39    51    13    20     7     7
  5   1   2  SIG                                      Xt7.1-CAAL8279.5              TCAGTCAGTTATTTTGGTGTGTGTGTGTGTGTGTGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAACTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAGGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATAGACGCGGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGGTAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAA
  5   1   2                                           Xt7.1-CAAM6082.3                                                                       AAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGGTATATATCTTAATTCTAAACCTTCTCTGGCATTCCTCATCATTTTACTTGTAGCACAGCCTTTTTAATAATAGAAATGATTGTTGTCTCTGCTTTGCTTCTAACATACCACCTTTTTCTTGTACAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGGTAAGTCAAACTAGAAATGTTTACATTGAAATATAGACTGCTGATGTGTTTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGA
  5   1   2  SIG                                    Xt7.1-TGas132d18.3                                                                            CTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACGAGCTCCAGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAA
  5   1   2                                          Xt7.1-CAAK13034.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGGTACAATTTCTCTAATGTACGGAAGTATAAATTGTGACTGAATAACACATATGAGTGCAATGTCTGTCACTAATACCTAAATGTTTCAGTGTTTTGCACACTTATCTAAGTCTTAGGCCATGTAATGCATCCAGGATCGGACTGGCCCAGCAGGACACTAGGGGAAACCCTGGTGGGTTCTGGCTCATCCTATGTGAGCACAGTTTTCTGCATCAGGGTACATATGCACTTGATAAGCCAATCAACAACCTGACCCCACAGTAGTAAAAATTAGTAATGCATCTGATTTGACTGCGTGTATCTCTAGTGTTTTACGGTGCTATGAAGAGTGCTGTGGATATAGTTTAAAACTACAGAAGTGAACAAATCAGATTCTGTGCAAGTTTTCCAGTACCAAGGGGTCGGCAGGCACTGATGGATTGAAAGAGGGGGCAGGGAAGGTGGGGGATAAGGTTGGAAGGTGCAGCTGCTTGTCAGGGAGGGAGATCAGAAGCAGCAGCATTAAAATCAGAGATGAGTAAGAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAC
  5   1   2                                         Xt7.1-TEgg006c17.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAACTAGTGTCGACGCGGCCGCTTTTTTTTTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                    TTTTCTGAGAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGCTTTTTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGCATACATGGTTTTTCTATATGTTCTGGTGTGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                T--A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----T------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----T----C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------C-
                                               BLH MIN     945     222                    
                                               BLH MPR      96     222                    
                                               EST CLI     327      19                    
                                                                                                                                                                                             PREDICTED - Ce ---- 4e-045     NP_490744.1 long chain fatty acid Coenzyme A ligase and a putative endoplasmic reticulummembrane protein, the two genes overlaping between their 3' and 5' UTRs (79.0kD) (1A982Co) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                          PROTEIN --- Sc ---- 3e-038     NP_010931.1 acyl-CoA synthetase (long-chain fatty acid CoA ligase) (fatty acid activator 2),activates endogenous but not imported fatty acids and provides substrates forN-myristoylation; Faa2p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 2e-049     XP_001183413.1 PREDICTED: similar to acyl-CoA synthetase long-chain family member 6 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PROTEIN --- Xt ---- 1e-048     AAH76898.1 Acyl-CoA synthetase long-chain family member 6 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 5e-164     NP_524698.1 bubblegum CG4501-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 0          NP_001034203.1 acyl-CoA synthetase bubblegum family member 2 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 0          NP_112186.3 bubblegum related protein [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ---- 0          NP_001012864.1 similar to MGC53673 protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PREDICTED - Dr ---- 0          XP_686467.1 PREDICTED: similar to MGC53673 protein isoform 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                    PROTEIN --- Xl ---- 0          AAI10944.1 MGC53673 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PREDICTED - ?? ---- 0          NP_001079494.1 hypothetical protein LOC379181 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas132d18.3.5                                                                                                                                      TGA---------------------------------------------------------------------------------------TGA------------------------------TGA------------------------TGA------------------------------TGA---------------TGA---------------------------------TGA------------------TGA---------------------------------------------------------------------------------------------------------------TAA------------------------------TAA------------------------------------------TGA------------------------------TAA------------------------------------------TAA---------ATG---------------------------------------------------------------------TGA---------------------------TGA---------------------------------------------------------------------------TAA---------------------TGA------------------TAA---------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------ATG------------------------ATG---------ATG---------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------TAG------------------TAG------------------------------------------------------------------------TAA------------TGA---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGA---------------------------------TAA------------------------------------------------ATG------------------------------------------------------------------------------TAG------------------TGA------------------------------------TGA---------------------TGA------------------------------------------------------------------------TAA------TGA---------------------------------------TAA------TAG------------------------TAG---------------------------TGA------------------------------------------------------------TGA------ATG---------------------------------------------------------------------------------------TAG---------------------------------------------------TGA------------TAA------------------------------------------------------------TAG---TGA------------------------------------------------------------------TAA---------------------------------------------TAA---------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAG------------TAA------------------------------------------------------------------------------ATG---TAG---------------------------------------------------------------------------------------TAATGA---------TGATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2  SIG                                      Xt7.1-CAAL8279.5              TCAGTCAGTTATTTTGGTGTGTGTGTGTGTGTGTGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAACTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAGGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATAGACGCGGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGGTAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAA
                                                  Xt7.1-CHK-1008273420                    AGTTATTTTGGTGTGTGTGTGTGTGTGTGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAACTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAGGGATGAGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATAxAxxxxGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGxxAAAACATTGAATAATTTATTGxxxTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAA
  5   1   2   14  ext Te4  5g3  in                         CAAN3227.5p .......GCTTAGTCAGTCAGTTATTTTGGTGTGTGTGTGTGTGTGTGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAACTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAGGGATGAGCTGAGGG
  5   1   4   14 seed Te4  5g3  in                         CAAN8213.5p .............TCAGTCAGTTATTTTGGTGTGTGTGTGTGTGTGTGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAACTGTGAAGCCAACATCATTGTGGTGGAGAATC
  5   1   2       ext Tad5      in                         XZT64333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCANGATTGCTGAGGCTGTGAAATATCTAGCATA
  5   1   3        nb Egg       in                   TEgg033p02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGCCCCACCATGAAATTAAAACGTCCAGTGGTGGCAAATATGTACAAAGACCTAATTGATAGCTTCTATCAGGATGCATTAACCCCCACTGAAAACTCCCCCCTCCTAAGTAGGGTCTTCTTAGTTGGCACATAAACAACACTCTCCTCCACAATTATGCTTACCATCCCGAGAATCCAGCAAAACAGCGCAAGATTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATTACCACATGTAACTATTCTTCACTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCACATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCATAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTG
  5   1   2       ext TpA       in                  TTpA049o21.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTTCAGTAGTGTTT
  5   1   2       ext Egg       in                   TEgg064j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATTACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATT
  5   1   3        nb Tad5      in                          XZT9506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATT
  5   1   2       ext Tail      in                         CBSW4996.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATG
  5   1   3        nb Brn4      in                        CAAL19760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCGAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATAT
  5   1   2       ext Brn4                                 CAAL8279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGNTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGT
  5   1   3        nb Egg                            TEgg111j10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACGCGGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACAT
  5   1   3        nb Egg                            TEgg111j11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACGCGGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACAT
  5   1   2       ext Egg                            TEgg111j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACGCGGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGGATTTATTTTGCATACATGGTTTTT
  5   1   3        nb Egg                            TEgg111j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACGCGGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATAC
  5   1   3        nb Egg                            TEgg111j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACGCGGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATACCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACCAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTG
  5   1   3        nb Egg                            TEgg111j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACGCGGCGCTTTTTTTTTTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTAATTTATATTTTGAATGGATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGAGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGGATTTATTTTGCATA
  3   1   2       ext Te4  5g3  in                         CAAN3227.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATCTTAATTTGAGGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGAT
  3  -1   3        nb Egg0                                 dad56e05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATATTTTGAATGTATAATGGACTCAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGNTGTATTTATTTTGCATACATG
  3   1   3        nb Brn4      in                        CAAL19760.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTCTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Tad5      in                          XZT5682.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATTTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGAT
  3   1   2       ext TpA       in                   TTpA049o21.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAA
  5   1   3        nb Tad5      in                          XZT5682.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATTTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGANAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGT
  3   1   2       ext Tad5      in                         XZT64333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGAT
  3   1   2       ext Tail      in                         CBSW4996.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCAGTCCTGTAAACCAGGATTATTTAGGTCATTTCTGCTCTTTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAA
  3   1   4      seed Te4  5g3  in                         CAAN8213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Tad5      in                          XZT9506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAAAGCAACGGGCTTAGGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCGAT
  3   1   3        nb Egg       in                    TEgg033p02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTGTGCGGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTGTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTCCCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATGTGATAAAAGCAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Eye  5x3  out                        CCAX6331.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       ext Egg       in                    TEgg064j06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-CAAM6082.3                                                                       AAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGGTATATATCTTAATTCTAAACCTTCTCTGGCATTCCTCATCATTTTACTTGTAGCACAGCCTTTTTAATAATAGAAATGATTGTTGTCTCTGCTTTGCTTCTAACATACCACCTTTTTCTTGTACAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGGTAAGTCAAACTAGAAATGTTTACATTGAAATATAGACTGCTGATGTGTTTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGA
                                                  Xt7.1-CHK-1008273416                                                                             TGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGGTATATATCTTAATTCTAAACCTTCTCTGGCATTCCTCATCATTTTACTTGTAGCACAGCCTTTTTAATAATAGAAATGATTGTTGTCTCTGCTTTGCTTCTAACATACCACCTTTTTCTTGTACAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGGTAAGTCAAACTAGAAATGTTTACATTGAAATATAGACTGCTGATGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAG
  5   1   2       ext Te3  5x3  in                         CAAM5909.5p                                                                       AAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGGTATATATCTTAATTCTAAACCTTCTCTGGCATTCCTCATCATTTTACTTGTAGCACAGCCTTTTTAATAATAGAAATGATTGTTGTCTCTGCTTTGCTTCTAACATACCACCTTTTTCTTGTACAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGGTAAGTCAAACTAGAAATGTTTACATTGAAATATAGACTGCTGATGTGTTTAAATA
  5   1   4      seed Te3  5x3  in                         CAAM6082.5p                                                                       AAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGGTATATATCTTAATTCTAAACCTTCTCTGGCATTCCTCATCATTTTACTTGTAGCACAGCCTTTTTAATAATAGAAATGATTGTTGTCTCTGCTTTGCTTCTAACATACCACCTTTTTCTTGTACAGNTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCT
  3   1   4      seed Te3  5x3  in                         CAAM6082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       ext Te3  5x3  in                         CAAM5909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  5   1   2  SIG                                    Xt7.1-TGas132d18.3                                                                            CTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACGAGCTCCAGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008273412                                                                                  CAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATxCTxxGAGCTCCAGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAAxxTxxxATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Brn3 5g3  in                         CAAK9523.5p GGGGCTGGCTTAGTCAGTCAGTTATTTTGGTGTGTGTGTGTGTGTGTGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTT
  5   1   2       add Te4  PIPE in                         CAAN1739.5p                                                  TGTGTAGCAAGGAGGCTGCTTGGTAAATACTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAACTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTC
  5   1   3        nb Brn3 5g3  in                         CAAK5154.5p                                                                            CTGCAGCAGAGGAGACAGCAGAACATCCTATTACCAAGATGCTGTTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAAACTTCAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATATCAGGATG
  5   1   2       add Te4                                  CAAN1217.5p                                                                                              GAAGTGGGAACTCGTGCTGCACCGGAGTGACATTACAGTGTGAAACAGACATGGCTGCTGTGGTTTCAAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCCATCATCCCATACAAGGATGAGCTGA
  5   1   2       ext Lun1      in                         CABD2501.5p                                                                                                                                                                 AAATTCTTCTACAACAGAGCTGTATATGGATACCACCAAAGCAACACAAGATTTGTGTATAAATGATGTAGTCCTATCCTCACCACAGTGCTATACTGAAGAAGCTCTCATGCAGTCTTCTGCTGACAACAGCACTACCAACACAAGAAAAAACAGTGAGAATCCCATAGTAACTGAGATTACCTCTGCAGCTGCCATGCTACATCCAGCTGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTC
  5   1   3        nb Egg                            TEgg077n13.p1kSP6                                                                                                                                                                                                                                                                                                                                                           CCGGGGGGCTTTTCTGAGAGCTCCAGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTG
  5   1   3        nb Egg                            TEgg134l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                           CCGGGGGGCTTTTCTGAGAGCTCCAGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATC
  5   1   3        nb Neu                            TNeu042l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                           CCCGGGGGCTTTTCTGAGAGCTCCAGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCAT
  5   1   0       chi Egg                            TEgg081m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                TCAGTGCTCCATATATATTATGAATGGGGATGGGAAATATAACCTGTACAGGTGATATTCTACTGTGTTTTGTTTTTTTGAAGCTTGTGTTATAATATCGGGTCCCTGTCTGGACACTAGAATACGGAATACATGGAAACAATTTTACTGTTAAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACAAAGCAATATTATGAGCAAATGCAAAATAGCCCCCCCAGGCTTCCTTAATTTGGGTTTGGAAATATACCATGGAGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCCCATGAGGGAACAATTTTTGCTGGTGGCTTTACTGTGGGCATCTATACCACAAATTCGGCTGACGCTTGCCATTATGTGGCACAGAATTGTGA
  5   1   2       ext Brn3      in                         CAAK9346.5p                                                                                                                                                                                                                                                                                                                                                                TGCAGCTGCCATGCTACATCCAGCTGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCA
  5   1   3        nb Gas7      in                         XZG23235.5p                                                                                                                                                                                                                                                                                                                                                                 GGCTTTTCTGAGAGCTCCAGAAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGA
  5   1   3        nb Egg                            TEgg100h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                   CTTTTCTGAGAGCTCCAGAAGGAAATCTGTCGACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGCGGAACTGCCAATGGAAGATTCATGTGTTGCCAGCTTGCCCCCTGTTACCTTTCACCAGATGTTCCAAGACACTGGTAACAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCATTGGCACAAAATGACATACTAGCAATATTATGAGCAGTGCCTAATAGCAGCAAAAGGTTTCCTTAACTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGAGGTTTAACTCTGCAGAATGGCTTATTGCACATGCGGGAGCTATTTTTGCTGGAGGCTTTGCTGCGGGCATCTATAC
  5   1   3        nb Egg                            TEgg129j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                          TCTGAGAGCTCCAGGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCAT
  5   1   4      seed Gas       in                   TGas132d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                            TGAGAGCTCCAGGATATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGA
  5   1   3        nb Egg       in                   TEgg050b16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                       GGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCT
  5   1   2       ext Gas       in                   TGas067b17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                       GGAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATC
  5   1   3        nb Egg       in                   TEgg056j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                        GAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGC
  5   1   3        nb Egg                            TEgg109h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                        GAAATCTGTCAACATCTGATATGAAGCTGTGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCT
  5   1   3        nb Lun1      out                        CABD7491.5p                                                                                                                                                                                                                                                                                                                                                                                                             AATCGGCACGAGGACAACACGGAGGGACAATGCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGANATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTG
  5   1   2       ext Ovi1      in                        CABI11195.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCGATTCGGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTG
  3   1   3        nb Egg       in                    TEgg056j13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGTGGAACTGCGAATGGAAGATTCAGGTGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGACACTGTTAAGAAGTATGGAGATTATGTGGCCCTTGCATCTAAGCAGGGAGATCAGTGGCACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGGGGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas097i10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAAATGACATACGAGCAATATTATGAGCAGTGCAGAATAGCAGCAAAAGGTTTCCTTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCAGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGA
  5   1   2       add Tbd0                               IMAGE:6980335                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGAGAAGCCATACAATTTCCCCTGCTACCACTTTATTGTGGAAATTTGAGTAACATCCAAGTTTTTTTTCCTCAGTGGCTTTGCTGTGGGCATCTATACCACAAATTCAGCTGAGGCTTGCCATTATGTGGCACAGAACTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACTTACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCAACAGCCTTATGGGTGTTCCAGAGTGTGGGAGAAATGCANGAGAAATGAAAGCTGTGGCGCTAGTCTCTACATCAACGAAAGTGCAACTGGGCAAAGTGTGGCTAGAACATCTGAGAATGATGATCACCTCTCATGATTCCGTGCAAAATGTTCAAATCC
  5   1   2       ext Lun1      in                         CABD2060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAG
  5   1   3        nb Int1      in                        CAAP14795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCT
  5   1   2       ext Ovi1      in                         CABI7197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCA
  5   1   3        nb Tad5      in                          XZT6853.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCC
  5   1   3        nb Eye       in                         CCAX2080.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGG
  5   1   3        nb Te3       in                        CAAM15919.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTNGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCA
  5   1   2       add In66                            IMAGE:8964190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTTATTTTTCCTCTTTAATTTAAAAAAAATTAACCCTGATGAGTGAAGTTCTGGCCCGCATTACCATTCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCTCCCACCATGAAGTTAAAACGTCCAGTGTTGGCAAAGATGTACTAAGACCAAACTGATAGCTTCTATCAGATGCAGTAAACCCCCACTGAAACATCCCCCTTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACACACTTCCTCCTCACCATTGCCTAACTCCTGAATCCAGCAAACAGCGCAGGTTCCCCCCCCCCCTTAAAATATTTTTTATATTTTGAAAACAAACGAAAACTATAT
  5   1   2       ext Liv1      in                         CAAR2021.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCCTCCTAAGTAGGGTCTTCTTTGTGGCACATAGACAACACTCTC
  5   1   3        nb Lun1      in                        CABD10093.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCANCATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCC
  5   1   3        nb Ovi1                                 CABI1729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATTAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCCTAA
  5   1   2       ext Ovi1      in                         CABI2182.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCANAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCT
  5   1   3        nb Ova1      in                        CABE11999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCANAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATT
  5   1   3        nb Te5       in                         CAAO7168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATC
  5   1   3        nb Lun1      in                         CABD4738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGG
  5   1   2       add Gas7      in                         XZG54999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGAACCAGAGGATGAGCTCACTCCAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACATCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCA
  5   1   3        nb Gas       in                   TGas130f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTACCGGAAGAATCAAAGAGCTGATAATTACAGCAGGTGGAGAGAACATTCCACCAGTTCCAATTGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCT
  5   1   3        nb Lun1      in                         CABD1961.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAGATGCCCTCAAAGAGCAGGTTCCAATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCT
  5   1   3        nb Gas7      in                         XZG45286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATAATCAGTAATGCCATGGTGATTGGAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCACAGCTCTGCCATTATAGACTTGTG
  3   1   3        nb Gas7      in                         XZG23235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGTAATGCCATGGTGATTGGAGACAAGAAGAAAGTCCATTCCAGGCTTGGTACTCAAAAGGGCAATGCGAAAGCGGACACAGGGGAACCAGAGGATGAGCTCACTCCGGACGCCACTCAGTTTTGTGGGCAGATTGGCAGCAAAGCCACAATGGTATCCGACATAGTCGGGGGCAAAGACTCAGCTGCATATGCTGCAACCCTGGACGGGGTAAATTCAGTAAATCAGAAGGCAACTTCAAATGCGCAGAAGGTCCAAAAGTGGGTTATCCTTGACCAAGATTTTTATATCGCGGGAGGAGAACTGGGCCCCTCCAAGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATCGATAGCTTCTATCAGGAGGCAGTAACCCCCACGGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTGGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCT
  5   1   3        nb Egg                            TEgg125i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGACAAGAAGAAATTCCTTTCCATGCTTCTTACTCTTAAGTGCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGC
  5   1   2       ext Tad5      in                         XZT30034.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAATGTGAATGCAGACACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTG
  5   1   2       add In63                            IMAGE:8958379.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCACAGGGGAACCAGAGGATGAGCTCACTCCAGAAGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCTTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAGCTGCTTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCTCACAGCTCTGCCAATTATAGACTTGTGGCACTCGCTGTTCTTGTGCAGCAACTGCGCTTACTGACGTAGATGTGCTTTTATTCGAATGACGAACTGAAGCAAAATGGAAATGGTTTGGCACGAACCAATACATCAGATGCTGAGGCTTTAAAATCTACCGTAGAGAATAGGGAA
  3  -1   3        nb Gas                             TGas136o19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCGCCATTGAGTTTTGTCGGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTATTGACGTAGGATGTGCTTTATCCGANATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAAGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATA
  5   1   3        nb Gas7      in                         XZG53665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCAGATTGGCAGCAAAGCCACACTGGTATCCGACATAGTCGGGGGCAAAGACACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAATTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGT
  5   1   3        nb TpA                            TTpA007l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCACACTGGTATCCGACATATTCGGGGGCAATACCACAGCTGTATATGCTGCAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCACATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCGACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAAATGGACCTTCCCAACAGCTCTGCCATTTATAGAACTTGAGGGAACCCGCTGTCCTTGTGCCACCAAACTGCGCTTACTGACGTAAGATGTGCTTTA
  5   1   3        nb Ova1      in                        CABE12428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATCCAGGATGGGGTAAATTCAGTAAATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTAT
  5   1   3        nb Neu                            TNeu040d12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGTAAATCAGAAGCAACCTCAAATGCGCAGAAGTCCAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACG
  5   1   3        nb Egg                            TEgg095o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCAGAAGGCAACCTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGT
  5   1   2       add Gas7      in                         XZG22599.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAAATGCGCAGAAGGTCCAAAAGTGGCTTATCCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCCAGGCGCCTCCTAAAAAGCTG
  3   1   3        nb Te5       in                         CAAO7168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTGACCAAGATTTTTCTATCGCTGGAGGAGAACTGGGCCCCACCATGAAGTTAAAACGTCCAGTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGT
  5   1   3        nb TpA       in                   TTpA049o23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGGCCCCACCATGAAGTTAAAACGTCCAGTTGGTGGCAAAGATGTACAAAGACCAAATTGATAGCTTCTATCAGGATGCAGTAACCCCCACTGAAAACATCCCCCCTCCTAAGTAGGGTCTTCTTGTTGGCACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTTCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTTATCAAGTAGTGTTTTTATACT
  5   1   3        nb Lun1      in                         CABD8419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACATAGACAACACTCTCCTCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACAC
  3  -1   3        nb Egg       in                    TEgg009h01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCCACAATTTGCTTACCTCCCGGAATCCAGCAAAACAGCGCAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTA
  5   1   3        nb Ova1      in                         CABE2330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGTTTCCCCCCCCCCCCCTAAATATTTTTATATTGAAAACAACAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTT
  5   1   2       add In54                            IMAGE:8943179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCCCGACACGCAGACGACCCCGCCCCACCCGATTCGTCCCTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAAATGATTATTGTGTTTGGCAGTGA
  5   1   2       ext Ova1      in                        CABE11954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCGATTCGAAAAAACTATTTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTTTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAAATGGGTGTTC
  5   1   2       add AbdN      in                     IMAGE:6997888.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCCTTTCACTCCATCTAAGATCACCACATGTAACTATTCTTCGCTGATGGAAGTCTGTTCACAGAGCAGGTTATTAAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAAGCCTGAAGTCTGTTGCAGG
  5   1   3        nb Gas7                                  XZG8047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  NAGGGTGCTGGTGAAAAATCAGATTCCGCTCAATGTACTAAGTGCCTCGCGAAGGGGATCTCCAACATATCCTTGTCTAAGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGNGTGTTTCTG
  3   1   3        nb Ova1      in                        CABE12428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCCACAGTGCTGCTGATCCTTATTGGCTAATGCAGTGCAAGGCGCCTCCTAAAAAGCTGCTCCTGACAATGATCCCAGCACAGCCGTGTCCTACACTGAGATGGACCTTCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTAATAAG
  5   1   2       ext Egg       in                   TEgg038j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGCCCAACAGCTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCT
  5   1   3        nb Tad5      in                         XZT15380.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTGCCATTTATAGACTTGTGGGAACCCGCTGTCCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTGTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTTGGCTGTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTT
  5   1   3        nb Ova1      in                         CABE4386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTGTGCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGGATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAA
  3   1   2       ext Egg       in                    TEgg038j19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCAGCAAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAAAAAAAAAA
  5   1   3        nb Ova1      in                         CABE7271.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACTGCGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTT
  3   1   3        nb Egg                             TEgg038j23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCTTACTGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTATGCTCTCTGCAGCCTTTGTTATGAGCTGGAAAAGGAAAATACTTGATAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas       in                   TGas064c14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACGTAGGATGTGCTTTATCCGAAATGAAGGAACGGAAGCCAAAATGAGTATTGTGTTTGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCT
  3   1   2       ext Brn3 5g3  in                         CAAK9523.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGACGTAGGATGTGCTTTATCGNAAATGAGGAACGGAAGCCAAAATGAGTATTGTGTTGGGCAGTGACACAATACAACTCAGGATTGCTGAGGCTGTGAAATATCTAGCATAGGAAAATATAGTAAATATAGTAAATGTTTTTTTTATATCTTAATTTTGAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGAT
  3   1   2       add Te4  PIPE in                         CAAN1739.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGTAAAAACATTGAATAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTGAT
  5   1   3        nb Gas                            TGas085l10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAATTTATTGCATTTTTTTAATTTATATTTTGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAA
  5   1   3        nb Gas7      in                         XZG21619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAATGTATAATGGAATTAGGGCCGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTTTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGC
  3   1   3        nb Ski1      in                         CABJ8986.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTGATAAAA
  5   1   3        nb Ski1      in                         CABJ8986.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAATCTTTAAATTATTCAAGTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAA
  3   1   2       ext Ovi1      in                        CABI11195.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCAAGTAGTGTTNTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTT
  3   1   2       ext Ova1      in                        CABE11954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAGTGTTTTTATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Int1      in                        CAAP14795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATACTCCAGACATCTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATANTAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTG
  5   1   3        nb Gas                            TGas004d22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGCCTTGATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTNGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGNTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCT
  3   1   4      seed Gas       in                    TGas132d18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATTTGCACTCTCCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA                             THdA022k21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGATTTGCACTCTCCATTATTTATATTGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAA
  3   1   3        nb Gas       in                    TGas130f21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Liv1      in                         CAAR2021.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTTGCACTCTCCATTATTTATATTGGTTTTATTATAGCACNTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Lun1      in                         CABD8419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCATTATTTATATGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       ext Lun1      in                         CABD2060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATTATTTATATTGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       ext Brn3      in                         CAAK9346.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTATATGGGTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Ova1      in                        CABE11999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATATTGGTTTATNTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       add Gas7      in                         XZG54999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATATGGGTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGAT
  3   1   2       ext Ovi1      in                         CABI2182.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Ova1      in                         CABE2330.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Ova1      in                         CABE7271.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       ext Ovi1      in                         CABI7197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Lun1      in                         CABD1961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAA
  3   1   3        nb Lun1      in                         CABD4738.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAC
  3   1   3        nb Egg       in                    TEgg050b16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAA
  3   1   2       ext Tad5      in                         XZT30034.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Lun1      in                        CABD10093.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Ova1      in                         CABE4386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       ext Gas       in                    TGas067b17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAACGCAATAATTAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG45286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGAT
  3   1   2       ext Gas       in                    TGas064c14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGCCCTGACTTTTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTTTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTTTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTGGTATTTATTTGGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCTCTTAATGAATAAATATCTGATAAAGCAAAAAAAAAAAAAAAAAAAA
  3   1   2       add AbdN      in                       IMAGE:6997888                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATATGCATGCGCACGTGGTTAGCACATATCAAGCTTCATATTACACACTATCTCTTTGGTGAGGCCTGAAGTCTGTGCAGGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATCTGTTAAATGTAATCATCCGCCCTATACAACTCTTNNN
  3   1   2       ext Lun1      in                         CABD2501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Gas7      in                         XZG53665.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTGCCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Lun1      in                         CABD8561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  5   1   3        nb Lun1      in                         CABD8561.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGANAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                         XZT15380.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Gas7      in                         XZG63130.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAACCAAAAT
  3   1   3        nb Brn3 5g3  in                         CAAK5154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGCCTGAAGTCTGTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Gas7      in                         XZG21619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGCCTGAAGTCTGTTGCAGGTTTTTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGAT
  5   1   3        nb Gas7      in                         XZG63130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTANATGTTTTTCCTTAATGAATAAATATCTGATANAAGC
  5   1   3        nb Gas7      in                         XZG10767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAGGGGACTGTTGGCCAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG10767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGGGGACTGTTGGCCAAAGCAACGGGCTTATGAGGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGTCTTCTAGGAGTGAGAGCCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAGCTCTATAAAAACTAAAGGAATCTGCCGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTATAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTACTATTTCTGTTGTATTTATTTTGCATACAGGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGCCTCAATTACCAAAGTGAAACCCAAATCTGCCATTAGTCGCTGTTC
  3   1   3        nb Eye       in                         CCAX2080.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGGGCTTATGATGTCGTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       ext Ova1      in                        CABE10290.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTGGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAT
  5   1   2       ext Ova1      in                        CABE10290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCaaaaaaaaaaaaaaaaaaaaaaaatttaaaaaaaaaaaaaaaaa
  3   1   0       chi Gas7      in                         XZG22599.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTGGTATTTATTTGGCATACAGGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATCCTTGATAAAAAAAAGAATGAGCCCCCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGGGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAAGGAATAAATTTCTGATAAAGGC
  5  -1   3        nb Egg       in                   TEgg009h01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAACTAAAAAAAAA
  5  -1   3        nb Gas                            TGas109j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAA
  3   1   3        nb Tad5      in                          XZT6853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTGGTTTCTATTTCTGTGGTATTTATTTGGCATACATGGTTTTTCTATATTTTCTGGGTGGGGGGGTGGGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTTTGAGCTGGAAAGGAAAATCCTTGATAAAAAAAAGAATGAGCCCCCCCAGCCTCAATTCCCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATCCCCAGGCCCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCCCTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAAGGAATAAATTTCTG
  3   1   3        nb Egg0      out                        dad64b07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTATTGCTGCCATACATTTTTGCTGCAGATTCCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTCCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas130j03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGTTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCCTTAATGAATAAATATCTGATAAAA
  5   1   3        nb Gas       in                   TGas130j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAACTCTATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGTTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGGTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCC
  3   1   3        nb Egg       in                    TEgg035o19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTTTCTGATGGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATTTGCTAACCCTGGTTTCTATTTCGGTGGTATTTATTTGGCATACATGGTTTTTCTATATGTTCTGGGTGGGGGGGTGTGTTTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTTTGCTTTCGGCACCCTTTGTTTTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCCCCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTTTGTTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTACCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATTTTTTCCTTAAGGAATAAATTTTTGGTAAAAGCAAAAAAAAAAAAAAAAAAAAAAGGAAAAAAA
  5   1   3        nb Egg       in                   TEgg035o19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAAAAACTAAAGGAATCTGCTGCATGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGATCTTTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCCAAAAAAAAAAAAC
  3   1   3        nb Te3       in                        CAAM15919.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  5   1   3        nb Gas       in                   TGas126e15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   3        nb Gas       in                    TGas126e15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb TpA       in                   TTpA049o23.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATACTTGAAAAAAAAAAGAATGAGCCCCCCCGGACTCAATTACAAAAGAGAAACCCAAATCTGTCATTAGTCGTTGTTAGGATAAGAAGAGGATACCCAGGACAGACGGGGAGGGATTAGCATTCCAATAGAATTAAGTGGTTTAATTTATCCATGCAATTTCATCCACTAGTCACAAAGTGGGGTCTTGGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAA
  5   1   2                                          Xt7.1-CAAK13034.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGGTACAATTTCTCTAATGTACGGAAGTATAAATTGTGACTGAATAACACATATGAGTGCAATGTCTGTCACTAATACCTAAATGTTTCAGTGTTTTGCACACTTATCTAAGTCTTAGGCCATGTAATGCATCCAGGATCGGACTGGCCCAGCAGGACACTAGGGGAAACCCTGGTGGGTTCTGGCTCATCCTATGTGAGCACAGTTTTCTGCATCAGGGTACATATGCACTTGATAAGCCAATCAACAACCTGACCCCACAGTAGTAAAAATTAGTAATGCATCTGATTTGACTGCGTGTATCTCTAGTGTTTTACGGTGCTATGAAGAGTGCTGTGGATATAGTTTAAAACTACAGAAGTGAACAAATCAGATTCTGTGCAAGTTTTCCAGTACCAAGGGGTCGGCAGGCACTGATGGATTGAAAGAGGGGGCAGGGAAGGTGGGGGATAAGGTTGGAAGGTGCAGCTGCTTGTCAGGGAGGGAGATCAGAAGCAGCAGCATTAAAATCAGAGATGAGTAAGAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAC
                                                  Xt7.1-CHK-1008273424                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGGTACAATTTCTCTAATGTACGGAAGTATAAATTGTGACTGAATAACACATATGAGTGCAATGTCTGTCACTAATACCTAAATGTTTCAGTGTTTTGCACACTTATCTAAGTCTTAGGCCATGTAATGCATCCAGGATCGGACTGGCCCAGCAGGACACTAGGGGAAACCCTGGTGGGTTCTGGCTCATCCTATGTGAGCACAGTTTTCTGCATCAGGGTACATATGCACTTGATAAGCCAATCAACAACCTGACCCCACAGTAGTAAAAATTAGTAATGCATCTGATTTGACTGCGTGTATCTCTAGTGTTTTACGGTGCTATGAAGAGTGCTGTGGATATAGTTTAAAACTACAGAAGTGAACAAATCAGATTCTGTGCAAGTTTTCCAGTACCAAGGGGTCGGCAGGCACTGATGGATTGAAAGAGGGGGCAGGGAAGGTGGGGGATAAGGTTGGAAGGTGCAGCTGCTTGTCAGGGAGGGAGATCAGAAGCAGCAGCATTAAAATCAGAGATGAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAA
  5   1   4      seed Gas7      in                         XZG50042.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACAGAATTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGT
  5   1   2       ext Brn3      in                        CAAK13034.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTGTGAAGCCAACATCATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGATTCAGGATCAGCTGCCACACCTTAAGGCAATCATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGA
  5   1   2       ext Brn3      in                         CAAK1459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCCAATACAAGGATGAGCTGAAGGAGAAGAGGCCTAACCTGTATACATGGAAAGAGTTCATGCAGCTGGGAAAAGACATCCCAGACTCTCAGCTAGACCAGATAATTTCATCTCAGAAGCCCAATCAGTGTTGCACCCTCATCTATACCTCTGGGACCACAGGGCAGCCTAAAGGAGTAATGCTAAGCCATGATAATATCACTTGGACTGCAGCATCAGCAGGAAAGACTGTGCGACTAAGAGAAGCTACTGATATGCAGGAAATTGTGGTTAGCTATCTGCCTCTTAGCCACATTGCAGCACAGATGATAGATATTTGGTTGACCATGAAGCATGGAGGGGCCACATACTTTGCTCAGCCGGATGCACTAAAGGGCTCGCTAGCCAACACGTTGCGTGAGGTAAGGCCAACAGCCTTTATGGGTGTTCCAAGAGTGTGGGAGAAAATGCAGGAGAAAATGAAAGCTGTTGGCGCTAAGTCATCTACAATCAAACGAAAGGTGGCAACTTGGGCCAAAGGTGTGGGCTTAGAGACAAATCTGAAGAAAATGAATGGATCAACACCTCATCCAATGAAGTATCACGTGGCAAAAAAATTGGTTTTCAAAAAAGTCCGCAAGGCTCTTGGACTGGACCGGTGCACCAAGTGTTACACAGGGGCGGCCCCCATCACCAAGGACACCTTAGAATTTTTCCTGAGCCTCAATATTCCTGTTTATGAGCTTTATGGGATGAGTGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGGAAAGTCATTTCAGGGTTGCAGACAAAAATAC
  5   1   2       ext Lun1                                 CABD5852.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAAGTTCTGGCCCGCATACCATCTCTTTGCCTGATGCCTTCAGAATCACCAGTTGTGGGAAAGTCATTTCAGGGTGCAAGACAAAAATACATCAGCCAGATAATGATGGCAGTGGGGAGATCCTTTTCTGGGGACGTCATGTCTTTATGGGATATCTGAACATGGAAGATAAAACCCAAGAGTCCTTGGATGAGGAGGGCTGGCTGCATTCTGGTGATATTGGAAAACACGATGAAAATGGATTTCTGTATATTACCGGAAGAATCAAAGGTACAATTTCTCTAATGTACGGAAGTATAAATTGTGACTGAATAACACATATGAGTGCAATGTCTGTCACTAATACCTAAATGTTTCAGTGTTTTGCACACTTATCTAAGTCTTAGGCCATGTAATGCATCCAGGATCGGACTGGCCCAGCAGGACACTAGGGGAAACCCTGGTGGGTTCTGGCTCATCCTATGTGAGCACAGTTTTCTGCATCAGGGTACATATGCACTTGATAAGCCAATCAACAACCTGACCCCACAGTAGTAAAAATTAGTAATGCATCTGATTTGACTGCGTGTATCTCTAGTGTTTTACGGTGCTATGAAGAGTGCTGTGGATATAGTTTAAAACTACAGAAGTGAACAAATCAGATTCTGTGCAAGTTTTCCAGTACCAAGGGGTCGGCAGGCACTGATGGATTGAAAGAGGGGGCAGGGAAGGTGGGGGATAAGGTTGGAAGGTGCAGCTGCTTGTCAGGGAGGGAGATCAGAAGCAGCAGCATTAAAATCAGAGATGAGTAAGAGCCACA
  3   1   2       ext Brn3      in                        CAAK13034.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCACCTGAAATAGACACGCAATCTTGACTGAATATGCAATGCGCACGTGGGTTAGGCACATATCAAGCTTCATTATTACACACTTATCTCTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAC
  3   1   4      seed Gas7      in                         XZG50042.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTGGTGGAGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTAAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   2       ext Brn3      in                         CAAK1459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGCCTGAAGTCTGTTGCAGGTTTCTAGGGAATATATTTATATACAAAGGGGACTGTTGGCCACAAAGCAACGGGCTTATGATGTCGTTTTCACTAAAAATCTGACCCTGTAACTACTGAATGGGTGTTTCTGAATGGGTGTTTCAGACCTGACTTCTAGGAGTGAGAACCAAAGATCCGGTTTGTATTGCTGCCATACATTTCTGCTGCAGATTCCCAACTCTATAAAAACGAAAGGAATCTGCTGCGTGTTTGTGGCTTTCTCTCTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  5   1   2                                         Xt7.1-TEgg006c17.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAACTAGTGTCGACGCGGCCGCTTTTTTTTTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008273410                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGTGTCGACGCGGCCGCTTTTTTTTTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAA
  5   1   4      seed Egg       in                   TEgg006c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAACTAGTGTCGACGCGGCCGCTTTTTTTTTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC
  3   1   4      seed Egg       in                    TEgg006c17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAACTAGTGTCGACGCGGCCGCTTTTTTTTTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg006c18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAACTAGTGTCGACGCGGCCGCTTTTTTTTTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTGGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGCAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg       in                   TEgg006c18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAATAGTGTCGACGCGGCCGCTTTTTTTTTGATTGGCTGTTCTAATGCTCAGTGAGCAGGAGTCGAAGTATCTGCTAAACCTTGTTTCTATTTCTGTTGTATTTATTTTGCATACATGGTTTTTCTATATGTTCTGGTGTGGGTGTGTGTGTCTGTTGCATTCCTGTAAACCTGGATTATTTAGGTCATTTCTGCTCTCTGCAGCCTTTGTTCTGAGCTGGAAAGGAAAATACTTGATAAAAAAAAGAATGAGCCACCCCAGACTCAATTACCAAAGTGAAACCCAAATCTGTCATTAGTCGCTGTTCTGCTAAGAAGAGGATACCCAGGACCGATGTGGAGGGATTAGCATTCCAATAGAATTTAGTGGTTTAATTTATCCATGCAATTTCATGCACTAGTCACAAAGTGGGGTCTTTGTGGCCATTATAGGAAAGGAGATTTCCTGCTGGTCTTTAATTTTTGGGAATTTGTTAAATGTTTTTCCTTAATGAATAAATATCTGATAAAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)