Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 26 Jul 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 480.0    0Xt7.1-XZG5405.3                           152 PI      72        126     1571                aldehyde dehydrogenase 1 family, member A2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012070920 Xt7.1-CAAN6211.5.5 - 178 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                           15    16    21    23    25    28    30    32    45    46    50    51    52    53    54    54    56    57    57    57    57    59    57    59    57    59    60    60    60    61    60    61    60    61    61    62    63    63    63    63    63    63    63    63    63    63    63    63    64    64    65    65    65    65    64    64    64    64    64    64    64    64    66    66    66    66    66    66    66    66    66    67    66    67    66    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    67    68    68    67    68    67    68    67    68    67    68    65    68    67    69    67    69    64    69    63    70    64    70    63    70    62    69    55    64    46    56    45    54    33    44    30    40    27    40    28    39    28    38    24    35    23    33    22    32    23    28    23    27    22    26    22    26    20    25    22    27    20    28    20    27    19    26    19    25    21    26    21    27    21    26    22    27    23    27    23    27    22    28    22    26    23    26    23    28    22    27    22    27    22    27    24    27    24    26    24    26    24    26    25    27    25    27    25    27    25    27    26    28    27    29    27    29    27    29    27    29    26    30    26    30    26    30    27    30    25    30    25    30    26    31    25    30    24    28    24    28    24    28    23    28    22    28    22    28    23    29    23    30    22    29    22    29    23    30    23    30    23    31    23    31    23    31    23    31    21    30    23    30    21    29    21    29    21    29    21    29    20    28    19    29    21    31    22    32    21    31    23    32    24    33    24    34    25    36    21    32    21    33    21    34    21    37    23    40    23    40    24    41    29    49    34    52    34    55    35    56    35    58    35    62    35    63    35    63    36    67    36    71    39    71    41    72    42    74    45    76    45    77    43    75    43    75    43    75    46    77    46    76    44    74    44    75    45    75    45    75    45    77    48    80    48    79    47    79    48    79    47    79    46    79    48    78    47    78    47    78    48    77    47    77    43    77    46    76    47    76    45    76    45    75    46    74    46    74    46    74    46    74    45    74    46    74    45    73    44    73    44    72    44    72    42    70    43    70    43    69    42    68    41    67    41    67    41    67    42    67    42    67    41    67    33    63    34    60    32    59    32    58    32    57    13    34    13    27    13    14    13    14
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCATTCAATGATTTTAGTCTCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAAAGGAAGTAGGATAAAATCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAAAGTGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGGAAAACTCAAACCTGCCCGATCGAGATCTGGCTGATTTCAGGCCGAATGTTGGTCGGGCAGGCCTGCCGTTCATGCCCATACAAAGGCAGATAAGCTGCTGAATCAGTCTTAAGGACTGACATCAGCAGCTAGAATCAGCCCGTGTATGGCCACCTTTAAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----G----A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --GT--------
                                               BLH ATG      59     497                                                                                                                                                       
                                               BLH MIN      35     324                                                                                                                                                       
                                               BLH MPR     -10     324                                                                                                                                                       
                                               BLH OVR      59      38                                                                                                                                                       
                                               EST CLI      -8      32                                                                                                                                                       
                                               ORF LNG      59       8                                                                                                                                                       
                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 2e-135     NP_015019.1 Glucose repressed. Utilizes NADP+ or NAD+ as a coenzyme equally well. (sold bySIGMA under the catalogue number A5550, according to A. Blomberg).; Ald4p[Saccharomyces cerevisiae] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 0          NP_498081.2 ALDH1J1, ALdehyde deHydrogenase (55.1 kD) (alh-1) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 0          NP_609285.1 CG3752-PA [Drosophila melanogaster] --=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                   PREDICTED - Sp ---- 0          XP_786787.2 PREDICTED: similar to aldehyde dehydrogenase 1A2 isoform 2 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                        PROTEIN --- Dr ---- 0          NP_571925.1 aldehyde dehydrogenase 1 family, member A2; retinaldehyde dehydrogenase 2 [Daniorerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 0          NP_038495.2 aldehyde dehydrogenase family 1, subfamily A1 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_000680.2 aldehyde dehydrogenase 1A1 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 0          NP_989908.1 aldehyde dehydrogenase 1A1 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001080951.1 aldehyde dehydrogenase class I [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          BAA76412.1 aldehyde dehydrogenase class 1 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PREDICTED = Xt ==== 0          AAH96010.1 Hypothetical protein mgc107771 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAN6211.5.5                                                                                                                                                                                 TAA------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------ATG------------------------------ATG------------------ATG---------------------------------------------ATG---------------------TAA---------------------------------------------------------------------------------------------------------------TGA---------------------------------ATG---------------ATG------------TAG---------------------------ATG------------------TAG------------------------------------------------ATG---------------------ATG---------------------TGA---TAA---------------------TAG---------------------------------------------------------------------------------------------------------------------------------TAA------------------ATG------------------------------TAA------TAA------------------------------------------------------TGA------------------------------TAG---------------------------------------------------------------TGA---------------------------------------------------------------------------TAA---------------------------------ATG---------------------------------------------------TAG---------------------ATG---------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TAA------------ATG---------ATG
                                                                   ORF                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       ext Int1      in                        CAAP10194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACAGTTGTCATCAAACCAGCTGAACAAACACCACTGACTGCTCTATACATGGGATCATTAATAAAAGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCAGGAGCAGCTATAGCCTATCATATGGAAATAGACAAAGTAGCTTTCACTGGTTCAACAGAGGTTGGAAAACTGATAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTC
  5   1   2       ext Mus1      in                         CABH9163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATCATTAATAAAAGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCAGGAGCAGCTATAGCCTATCATATGGAAATAGACAAAGTAGCTTTCACTGGTTCAACAGAGGTTGGAAAACTGATAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAAT
  5   1   3        nb Tad5                                 XZT51690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCAGGAGCAGCTATAGCCTATCATATGGAAATAGACAAAGTAGCTTTCACTGGTTCAACAGAGGTTGGAAAACTGATAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACA
  5   1   2       add In63                            IMAGE:8958896.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTAATCATATGCGAAATTTGACAAAGTAGCTTTCACTGGTTCAACAGAGGTTGGAAAACTGATAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGAGATATGGTCTGCATGATACACTGAAGTCAGACAGTCATCATGAAATTCCACAGAAGATTCCTAAAATGTCACAGCACTGATTTCCCGATGCCTGAGATCGTGATACTGGCATATTTTTTGTGGTGTTTATCTGAATCTACAACGCTGCCAACATTTGGGTGCTGTGAGGATCTCCTTTATATTATAGGAGGTGACATGGGATATCACC
  5   1   2       ext Spl1      in                         CABK8662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGAGGGACAAAGTAGCTTTCACTGGTTCAACAGAGGTTGGAAAACTGATAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAAACACAGCTGCAAACATTT
  5   1   2       add In54                            IMAGE:8841064.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTTATTTAAACCTTTAACTTACATATAAAGAATTCGTCCCGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAGATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCATGGAAATACTGCCATATTTTTTGGTGTGGTTTAATCTGATTCTACACAGCTGCAACATTTGTGTGCTGGTGAAGATCTCCTTTATTATTATAGTGAAGTGGACCATGGCTATCACTTGTTCCAATGTTGGAAACAAATAGACCGTAG
  5   1   3        nb Lun1      in                        CABD13371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGAATCTAAACACAGCTGCAAACATTTGTGGTGCTGT
  5   1   3        nb Sto1      in                         CABG7048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGAATCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTAT
  5   1   2       add In63                            IMAGE:8960128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTTTTTTTTATTTCAAAGATTAAATAAAAAAAAAAAAAACCCCGGATTTGGAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATCTAACAACAGCTGCAAACATTTGTGTGCCTGTGAAGATCTCTTTATTATTTATAGTGAGTGACATGCAATCACTGTCAATATGGTTGAAAACAATAGACTTTTGTGTGTTACCTGATCCCTGGCCAATGCG
  5   1   3        nb Fat1                                 CABC5843.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTTGAAGATCTCCTTTATTATTATAGTGAAAGTGACCATGGTATCACTTGTCAATATGTTT
  5   1   3        nb Te1       in                        CBWN16538.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCATGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACT
  5   1   3        nb Fat1      in                         CABC6841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGCTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGNTCTG
  3   1   3        nb Te1  5g3  in                        CBWN14469.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTTTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCATGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGAAAAAAAAAAAAAAA
  5  -1   3        nb AbdN                               IMAGE:7006470                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGACCCCAATCCTATGATGGAAATTTGGGCGTAAAGAAGTGTTGAAAGGGCCCAAAAAAACGTGTTCTTGGAAGATCCTCTTTCCTCCTTGTGTAAACCAAAGACCCACAGATTGACAAGGATCATTTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTTTCAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Int1 5g3  in                         CAAP7640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTC
  3   1   3        nb Lun1      in                         CABD2538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCAAAAAAAAAAAAAAA
  5   1   2       add In60                            IMAGE:8951364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGTTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATTAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATACGGCCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACATATACCCAGCATATCATGCTGTCCCTGTCACAGTCTGTGTTTATGATCTGGTGCAGCTCATCATGATTTAGTCTCGTTATCTGAATAGGTTGCTAGGAAGAAGTAGGATAAATCAATGTAGAATCTTGAATATATTTAGAG
  3   1   3        nb Te5       in                         CAAO2705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAATTCGACAAAATTCTGAATTGATTGAGAGTGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTC
  5   1   2       add In66                            IMAGE:8964945.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATATTATATAATGATAGAGGATTACATAAGAATTCGAATTCGTCCCGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGAATAAATCATATGTAAAGTATACTGGATATTATTAGAAGTGTTCTAGGTTGCCAAGTAATATACAAGGATGGAAAAAAACACAGCAAAGTGCTGCCATATATTATTATATATTTAAAGGCAAATATTATTTAGAGA
  5   1   2       add In60                            IMAGE:8948798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGTTTATCATTACCTATTTTAATTTGATTCGAATTCGTCCCGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTAACCCTTGAATTTAATGTTTTGCTAGGAAAGAGTAGATAAATCATATGTAAAGTATACTGGAATATATTAGAGTGTCTAGTTGCAAGGTAAATATACCAGAGTAAAAACACAGCAAGTGCTGCATATATATATTTATTAGCCAATATATTTAAGAAAGGATTGCAGTGGATGCTAATCTGGATCCCATGCACACTTAGTCTTTAAAGCCTTATAAG
  3   1   3        nb Te1       in                        CBWN16538.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCATGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAAAAAAAAAAAAAA
  5   1   3        nb Sto1      in                         CABG3281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCNAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAAT
  5   1   0       chi Sto1      in                         CABG4709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATTTACTAATAATGAGCTTTTTATTACATTTCCTGTCTACTCATACAGATGTCCTGCTGTACTTGCACTATAATGGCTCATTGAAATGCAAAACAGAAATTATTCAGAAAGCATTTTGTAACATTTTGTCCTGTCTGACTTTAGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAAT
  3  -1   3        nb Int1      in                        CAAP14171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGT
  5   1   3        nb Liv1      in                         CAAR2786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATTGATGAAGTTATTAAACGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTTAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGT
  5   1   2       add In60                            IMAGE:8948455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTTTATTCAGGGAAAAAAGTGTTTCATATTCGTCCGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATTAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATACGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAAGTGACCATACATGGTAGAGCCGCTCGTTGGCAAGCCCTGAGCCAACAATCGAATTAAACAGCGGTATAGGTGCTGTTGTTCGGGGACCAGTTCGATGGAAACTCTAAACTGCCGATCGAGATTCTGCTGATTTCAGGCGATGTGTTCGGCAGGCTGTCGTTCCATGCTCAATCATAGAGCGTG
  5   1   3        nb Sto1      in                         CABG3238.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcanacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatancaaggcagataGGCTGCTGAATCAGTC
  5   1   3        nb Lun1      in                         CABD9819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggC
  5   1   3        nb Sto1                                CABG11246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcanacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATT
  5  -1   3        nb Int1      in                        CAAP14171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTCAATATGTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTNTATGATCTGGTGCAGAAATCATTCAATGATNTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAACCTG
  3   1   2       ext Int1      in                        CAAP10194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCAATATGTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAA
  5   1   0       chi Tad0                               IMAGE:6983883                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGGAAAACTCAAACCTGCCCGATTCGAGATCTGCCTGATTTTCAGGCCGAATGCTGGTCAGGTAGGGCTGTCGTTCATGCCCATTCACGGAAGAAAACCTGCTTTATCGTTTTTTAGACTGCCATCTGTGATACTTACCTCCTTTTTTGTTGGTTATTTCTAATTTTACTCATAGTTTTTTTAAGTATTTTTTTTTTAGATTAAGTTTTCTAGTGTTTTCGATAAAATATTCTTCAACGTCCTGGATTGC
  3   1   2       add AbdN FL   in                       IMAGE:7007049                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCCTAGGTCACCGTGTTTATAGGGCCCATTATTCCCCCGGGCATATTCATGGGCGGTCCCCCGTCACACAGGTTCGGGGTTTTTAAGGATTCGGGGGGCCGGAAATCCATTCCAAAGGTTTTTAGTCTCCGTTTAACCCCTTAAATTATAAAATTTTTGTTTGGAAAAAGGGAAGTAGGGATAAAATCATATGTAAAAGTTTACTGGGAATATATAGGAAAGTGTTTGTTGCCAAAGTTAAATTTTCCAGGAGGGGAAAAAAACACAGCAAAAGTGCTGCCCTATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTTGGAATCACCAAAGTGCACTACTTTAAGTCTTTTAAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgagcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccaccttTAAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGGTAAAAAA
  3   1   3        nb Int1      in                        CAAP13995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAATAGACTTTTGTGTTACTGATCTNGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTNTATGATCTGGTGCAGAAATCATTCAATGATNTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTGGCAGTTGCCTCTCGCCCTATA
  3   1   3        nb Lun1      in                        CABD13371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTTTTCAAA
  3   1   3        nb Sto1      in                         CABG3238.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCTTGCAGTGCATGACCTCATGGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTGCTAGGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataggctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTCAAAAAAAA
  3   1   3        nb Lun1 5g3  in                         CABD4610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATNTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTGTTTCAAACCTC
  5   1   3        nb Lun1      in                        CABD13453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAAACGGGCAATTCATGGATCGTCTCATGAGTG
  3   1   3        nb Fat1 5g3  in                          CABC802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATNTTAGTCTCGTTTAACCCTTGAATTTAAAGTTNTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAA
  5   1   3        nb Te4       in                         CAAN2061.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTAC
  5   1   3        nb Sto1      in                         CABG9462.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGA
  3   1   3        nb Lun1      in                         CABD1292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTTACCCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Sto1      in                         CABG3281.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       add Sto1      in                         CABG4709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTGCTAGGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Fat1      in                         CABC6841.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAAATCATTCAATGATNTTAGTCTCGTTTAACCCCTGNAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Mus1      in                         CABH9163.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAAAAAAAAAAAA
  3   1   2       ext Spl1      in                         CABK8662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAGATGCTGAG
  3   1   3        nb Lun1      in                         CABD8569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAAAGTTTTGCTAGGAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Int1      in                        CAAP13116.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGAATTTAAAGTTCTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCA
  3   1   3        nb Lun1      in                         CABD9819.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAATTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4  5g3  in                         CAAN3601.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAATTTTAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Liv1      in                         CAAR5117.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTAAAAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Liv1 5g3  in                        CAAR12385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGTTTTGCTAGGAAAAGGAAGTGGGATAAATTCTTATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATTCAAGAGGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTGTTTCAG
  3   1   3        nb Liv1      in                         CAAR1849.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Lun1      in                        CABD13453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAGATGCT
  3   1   3        nb Sto1      in                         CABG3753.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Liv1      in                         CAAR2786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAGGAAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Sto1      in                         CABG7048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Fat1      in                         CABC1917.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATATTAGAAGTGTTTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTT
  3   1   3        nb Sto1      in                         CABG9462.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te1       in                         CBWN4585.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGATCCGCTCATTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAATCCGATGGAAAACTCAAACCTGCCCGATCGAGATCTGCCTGATTTCAGGCCGAATGTTGGTCGGGCAGGCCTGCCGTTCATGCCCATACAAAGGCAGATAACCTGCTGAATCAGTCTTAAGGACTGACATCAGCAGCTAGAATCAGCCCGTGTATGGCCACCTTTAAGCATCTAGTTATACAGAGATGGTGTTACACTGGAGCAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCACCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAAAAAAAAAAAAAAA
  3   1   3        nb Te4       in                         CAAN2061.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4       in                        CAAN10876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4       in                        CAAN11515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4  5g3  in                         CAAN8395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te5       in                         CAAO8663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   4      seed Te4  5g3  in                         CAAN3712.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGCAAATATTTAAGAAAAGGAATGTAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTCTTCTTTC
  3   1   3        nb Te4  5g3  in                         CAAN3061.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te1  5g3  in                         CBWN5098.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGATCCGCTCATTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAATCCGATGGAAAACTCAAACCTGCCCGATCGAGATCTGCCTGATTTCAGGCCGAATGTTGGTCGGGCAGGCCTGCCGTTCATGCCCATACAAAGGCAGATAACCTGCTGAATCAGTCTTAAGGACTGACATCAGCAGCTAGAATCAGCCCGTGTATGGCCACCTTTAAGCATCTAGTTATACAGAGATGGTGTTACACTGGAGCAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCACCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAAAAAAAAAAAAAAA
  3  -1   2       ext Sto1      in                         CABG6404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAAAAAAAAAAAAAAAAAACTCG
  5  -1   2       ext Sto1      in                         CABG6404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te5  5g3  in                         CAAO1664.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTAAGAGCCCCTCGTTGGCAAGGCCCTGGGGCCCACCCATCGAATTTGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCCGTTCGATGgaaaactcaaacctgcccgatcgagatttggctgatttcaggccgaattttggttgggcaggccttccgttcatgcccatacaaaggcagataagctgctaaatccgttttaagggctggcatccgccgctagaatccccccgGTTTTGGCCCCCTTTAAGCCTCTAGTTTTACAGAGATGGGGTTTCCCTGGAACAGCTTAGTTTTTCCCGCTGGTATATAAAATGATTCCGAAAAAAACAATTCCTTTTTTTTGGGGGAGGGGGTAAAACAAACTGCTGTTTAAAAGTAGGGCTTTTCAAAAATGCCTTCCATATCGATTTTTTCCTCCCCCTGGGACTCAAGACAATGGGAATTTAATTTTTCCTTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTTAAAAACAAAACCGGCAATTCATGG
  3   1   3        nb Te3                                  CAAM4782.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGATTCAGCGGGTATAGGCGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcttacctgcccgatcgagatctggttgatttcaggccgaatgttggtcgggcagccctgccgttcatgcccctacataggcagataaggtggtaattcagttttaaggactgacatcagcagctagaatctccccggttatggccaccttTAAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTGCCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGGGGTATAAAAGTAGAGCTTTACAAAAATGCATTGCATATCGATTTTTGCCTCCCCTGGGAACTCAAGACAATGCGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Sto1      in                         CABG6276.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAAAAAAAA
  5   1   3        nb Sto1      in                         CABG6276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAAAAAAAA
  5   1   2       ext Te5       in                         CAAO8816.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACAGTTGTCATCAAACCAGCTGAACAAACACCACTGACTGCTCTATACATGGGATCATTAATAAAAGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCAGGAGCAGCTATAGCCTATCATATGGAAATAGACAAAGTAGCTTTCACTGGTTCAACAGAGGTTGGAAAACTGATAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTG
  5   1   2       ext Te5       in                        CAAO10751.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGganaactcanacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaat
  3   1   2       ext Te4  5g3  in                         CAAN6645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTACCCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te4  5g3  in                        CAAN12621.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAAATCATTCAATGATNTTAGTCTCGTTTAACCCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4  5g3  in                         CAAN5649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTTGAATTTAATGTTTTGCTAGGAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   4      seed Te3  5g3  in                         CAAM9749.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te3  5g3  in                         CAAM5863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te5  5g3  in                         CAAO1473.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4  5g3  in                         CAAN3215.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAGNAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te5       in                         CAAO8816.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4  5g3  in                         CAAN4334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGTGTCTAGTTGCAAAGTTAAATATNCAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te5       in                        CAAO10751.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAAGTAGAGCTTTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTTTCAAAAACAAAACCGGCAATTCATGGATCGTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  5   1   2       ext Te5       in                         CAAO3945.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGACAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATACTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCGTGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTG
  5   1   2       ext Te1                                 CBWN14269.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCATGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGATCCGCTCATTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCA
  5   1   3        nb Te1                                 CBWN11232.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAAAAATGTCACAGCACTGATATCCCGAATGCCTGGAGGATCATGGAAATACTGCCATATTTTTGTGTGTTTAAATCTGATTCTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGATCCGCTCATTGGCA
  5   1   3        nb Te4                                 CAAN12304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAACAACAGCTGCAAACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctaaatcagtcttaaggactgacatcagcagctagaatcaccccggttatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAACAATTCCTTTTTATT
  5   1   2       ext Te3       in                         CAAM1843.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAACAGCTGCCACATTTGTGGTGCTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTTGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTT
  3   1   4      seed Te5       in                         CAAO7829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTGAAAGATCTCCTTTATTATTATAGTGAAGTTGACCATGGTATCACTTGTCAATATGTTAGGAAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTC
  5   1   3        nb Te5                                  CAAO5828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAACAATAGACTTTTGTGTTACTGATCCTGCAGTGCATGACCTCATTGTCACTGTTATAGACAATATACCCAGCATATCATGCTGTCCCTGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGATCCGCTCATTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAATCCGATGgaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataacctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAGCAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCA
  3   1   2       ext Te4  5g3  in                         CAAN3770.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTCACAGTTCTGTGTTTTATGATCTGGTGCAGAAATCATTCAATGATTTTAGTCTCGTTTACCCCTTGAATTTAATGTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te3  5g3  in                         CAAM7124.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAAATCATTCAATGATTTTAGTCTCGTTTAACCCTGAAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  5   1   2       ext Tad5      in                         XZT46897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAATCATTCAATGATTTTAGTCTCGTTTAACCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAAAAAAAAA
  3   1   3        nb Te4  5g3  in                         CAAN4494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTCTCGTTTAACCCCTTGAATTTAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4  5g3  in                         CAAN8288.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAATGTTTTGCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAGNAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Tad5      in                         XZT46897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTAGGAAAAGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4  5g3  in                         CAAN2183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGAAGTAGGATAAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATACAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te3       in                         CAAM1843.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATCATATGTAAAGTATACTGGAATATATTAGAAGTGTCTAGTTGCAAAGTTAAATATNCAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   3        nb Te4  5g3  in                        CAAN12521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATATTAGAAGTGTCTAGTTGCAAAGTTACATATTCAAGAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGGTAAAACAAACTGCTGTATAAAACTGCTGTACAAACAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAG
  3   1   3        nb Te5       in                         CAAO2760.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGGGAAAAAACACAGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGCGTGTAATAAATAAGCTTTTTTTCTTTCAG
  3   1   3        nb Te3  5g3  in                         CAAM1564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAAGTGCTGCCATATATATATATATAAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te5       in                         CAAO3945.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGCAAATATATTAAGAAAAGGAATGCAAGTTGATGCTAAATCTGGAATCACCAAGTGCACTACTTTAAGTCTTTTAAAAATGCTTTATAAAGGTGACCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTC
  3   1   2       ext Te4       in                         CAAN7796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCAG
  5   1   2       ext Te4       in                         CAAN7796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATACATGGTAAGAGCCGCTCGTTGGCAAGGCCCTGAGGCCAACCAATCGAATTAGAACAGCGGGTATAGGTGCTGTTGGTTCGGGGACCCCAGTTCGATGgaaaactcaaacctgcccgatcgagatctggctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaAGCATCTAGTTATACAGAGATGGTGTTACACTGGAACAGCTTAGTTTTACCAGCTGGTATATAAAATGATTCAGAAAAAAAACAATTCCTTTTTATTGTGGTAGGTGCTAAAACAAACTGCTGTATAAAACTGCTGTACAAAAATGCATTACATATCGATTTTTACCTCCCCTTGGAACTCAAGACAATGTGAATTTAATTTTTCATTCAAATGCGCCTTTGTGCTTGGCAGTTGTATCAAATACAAAACCGGCAATTCATGGATATTCTCATGAGTGTAATAAATAAGCTTTTTTTCTTTCNGAANAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (