Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 06 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 252.0    0Xt7.1-TTpA071g20.5.5                     3874 PI      76        463      954                hypothetical protein LOC549413 [Xenopus tropicalis]
     2 212.0    0Xt7.1-TTbA009a10.3                        322 PI      78        462      791                Unknown (protein for IMAGE:5542952) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012071002 Xt7.1-CABJ985.3.5 - 106 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABJ985.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGGATTTGGTGGAGGAGCTGGTGGGGTATATGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAAAAA
                                                  Xt7.1-CHK-1008223084                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGGTGGAGGAGCTGGTGGGGTATATGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     4     5     5     5     5     5     6     6     8     8     9     9    15    15    20    20    23    23    27    27    29    29    31    31    32    32    34    34    34    35    37    37    39    39    41    41    41    41    42    42    42    42    42    42    42    42    42    42    42    42    42    42    43    43    43    43    43    43    43    43    43    43    45    45    45    45    46    46    46    46    46    46    46    46    46    46    46    46    47    48    47    48    49    50    50    53    52    54    55    56    57    58    58    59    61    63    63    65    66    67    68    69    72    75    75    77    78    79    81    82    82    83    82    84    86    88    87    91    87    91    87    91    85    90    85    91    84    90    81    90    80    89    84    92    84    92    84    92    81    88    80    87    76    87    79    86    75    82    74    81    74    80    65    72    63    69    62    68    61    68    63    69    63    69    63    69    61    68    61    67    60    67    59    65    59    65    57    64    55    62    55    61    54    61    57    63    55    61    40    61    39    59    39    59    39    59    45    59    44    58    44    58    44    58    44    58    43    58    42    56    42    56    42    54    42    54    42    54    42    54    42    54    42    54    42    54    42    54    42    45    41    41    41    41    40    41    36    39     3     4
  5   1   2  SIG                                      Xt7.1-CABJ4134.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGGTGGAGGATTTGGTGGAGGAGCTGGTGGGGTATATGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAAAA
  5   1   2  SIG                                       Xt7.1-CABJ985.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGC
  5   1   2                                           Xt7.1-CABJ1736.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTATAGGGCGAGAGCCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTTAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGG
  5   1   2  SIG                                     Xt7.1-CBSU10011.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGTGTAGGACTGGCCAGACCGGGGGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGAGTGAGTGTAGGACAGGCCAGACCGGGGGGAGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGAGTGAGTGTAGGACTGGCCAGACCGGGGGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTTAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGACTGTGACGTAGTTGGCTGGCTTGAATAAAACACCTTCGGACATGCACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGGGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGAACTTTACAATAGTTTACCTTTAGAGTCTTGGCATTGTATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCTCATGGTCCTCAACCCAACATTTTTAAAGATCCATCATGGTTGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAATAGTTTACCTTTAGAGTCTTGGCATTGTATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCTCATGGTCCTCAACCCAACATTTTTAAAGATCCATCATGGTTGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCATCCAGGAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATACTCGCTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------A----
                                                                       ...PROTEIN --- Sc ---- 2e-008     NP_014149.1 coiled-coil protein, contains a purine-binding domain, two heptad repeats and ahydrophobic tail; Rad50p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 2e-021     NP_495136.1 intermediate Filament, B, Variable ABnormal morphology VAB-21 (vab-21)[Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sp ---- 1e-025     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] -------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 5e-028     NP_523742.2 CG10119-PA [Drosophila melanogaster] -------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 5e-051     CAA11448.1 intermediate filament protein D1 [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 3e-056     CAC24550.1 intermediate filament protein IF-A [Ciona intestinalis] -------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Br ---- 2e-066     CAA09068.1 intermediate filament protein E1 [Branchiostoma lanceolatum] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dr ---- 3e-120     NP_001003445.1 zgc:92533 [Danio rerio] -----------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Xt ---- 1e-130     AAH87788.1 Hypothetical LOC496660 [Xenopus tropicalis] -------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 5e-135     NP_032495.1 keratin complex 1, acidic, gene 15 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 7e-140     NP_000214.1 keratin 12 (Meesmann corneal dystrophy); Keratin-12; keratin 12 [Homo sapiens] -------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ---- 5e-156     XP_425874.2 PREDICTED: similar to K12 keratin [Gallus gallus] ------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- ?? ---- 0          NP_001079175.1 adult keratin XAK-C [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xl ---- 0          AAH81253.1 LOC446967 protein [Xenopus laevis] -------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABJ985.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2  SIG                                      Xt7.1-CABJ4134.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGGTGGAGGATTTGGTGGAGGAGCTGGTGGGGTATATGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAAAA
                                                  Xt7.1-CHK-1008278570                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGGATTTGGTGGAGGAGCTGGTGGGGTATATGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTA
  5   1   2       ext Ski1      in                         CABJ9705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTTTGAAGGTGGCTATGGAGTTGAATGTAATGAAGGTTTTGGAGCTGGAGGTTTTGGTGGAGGATTTGGTGGAGGAGCTGGTGGGGTATATGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTNCATGACATGAGGGAGCAATATGAAACCCTGGGCTGAAAGACAGAAG
  5   1   2       ext Ski1      in                         CABJ1984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGGTGGAGGATTTGGTGGAGGAGCTGGTGGGGTATATGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAG
  5   1   2       ext Ski1      in                         CABJ4691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGANAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGANACGGTCCCTTCAGGGATTGGAGATAG
  5   1   4      seed Ski1      in                         CABJ6597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAANACGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAAACATCATTGGAGAAAACCCT
  5   1   3        nb Ski1      in                         CABJ4134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACA
  5   1   3        nb Limb      in                        CBSU9389.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATTATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCCCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGANAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGNCAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGAT
  5   1   3        nb Limb      in                        CBSU6847.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTTGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGAT
  3  -1   3        nb Ski1      in                         CABJ7482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCC
  5   1   3        nb Limb      in                        CBSU6890.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATTATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCCCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGNAACGGTCCCTTCAGGGATTGGAG
  5   1   3        nb Limb      in                        CBSU6214.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGG
  3   1   2       ext Ski1      in                         CABJ9705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   4      seed Ski1      in                         CABJ6597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAAAAA
  3   1   2       ext Ski1      in                         CABJ1984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGATATTATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   2       ext Ski1      in                         CABJ4691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTACTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAAAAA
  3   1   3        nb Ski1      in                         CABJ4134.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Ski1      in                         CABJ9788.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGA
  5   1   3        nb Ski1      in                         CABJ9788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGA
  5  -1   3        nb Ski1      in                         CABJ7482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAA
  3   1   3        nb Limb      in                        CBSU6847.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCC
  3   1   3        nb Limb      in                        CBSU6890.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGCCCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTC
  3   1   3        nb Limb      in                        CBSU6214.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb      in                        CBSU9389.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGGGGCCCGGTTTAATGGGCGGGGCAAAGATATAAAGAAAGAAATTTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATTTCAGATTTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGGGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTTTGTTTTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGGGGGGCAGCTGTTCCAACTGAGAAATGACATGGGGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGGGATAGAGACATATCCCAAGTTGCTGGAAGGAGAGGGGGGATTCTTCCAGGCCAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTTTTCGAGCGTCCGCGAAATCGGGGGGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTTTGCAGAGTTTTTACCTTTTTGACTCTCGGGGTAATGCTTATTCCCAAGGGCAGAACTGCTTTCCTTTCCAACATTTTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  5   1   2  SIG                                       Xt7.1-CABJ985.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGC
                                                  Xt7.1-CHK-1008278568                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCAT
  3  -1   0       add Ski1      in                         CABJ9597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CaacagagccttctattggcttcagtccacacaggggctaccaaatagccaattatagcactatatttgcacccccaggaacttttttcatgcttgtgttgctccccaacacgttttccttttgaatgtggctcccaggtataaaaggttggggatccctgCACTAGATCATTGTATAAAAGGGCTATGATAGTAACGGATTTAGTCTCTCCCGAATTTGGTAATCTCATTTAATTGGAGAGCTACCACCAAGACATCTATTCGCCAGTCACAGTCAATGGGCGGTGGCCCCAATGTGTCTGTCAGGAAACCTGATTATGGGAGGAGTATAATCAGTAAACTATAGCGCCACCAATAGAACTTATGTGAGGGTAAATGTTGGTTCTCGCCCCATATTGCTTAGACACAACATATGGCATATATGACTGGTGTCTTAAGACCTCTTTGAATAAGTTGTGGAGTGAAAATTCCGTCtagagcagtggttctcaaccttcctaatgccacaaccctttaatacagttcctcatgttgtggtgacacccaaccataaagttattcctaagaccatcggaaatatgtgttttacaacggtctttggcgacccctgtgaaagggttgttcgacccccaaaggggtcccgacccacaggttgagaaccactgGTCTAGGGTTTGTAGTTACAAATCTATAGCAGCCAGAGAAAAATAAATGTCTGCAAAAAGCTACTAGATCTAGTTATCCTTCACGGGCTAGGAAATTTCAAGCAAAATGAATGAGCATTTTTCACCTTTAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAA
  5   1   2       ext Ski1                                 CABJ9866.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGTTTTGGAGCTGGAGGTTTTGGTGGAGGATTTGGTGGAGGAGCTGGTGGGGTATATGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGC
  5   1   2       ext Ski1      in                        CABJ10250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATCGATTCAATTCGGCCGAGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGNCAGTACAGTCCAACACTACAGAGATCT
  3  -1   3        nb Limb      out                        CBSU671.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGGAGCTGGTGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTTGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATG
  5   1   3        nb Abd0                               IMAGE:7002784                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGGGGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGACAGAAGAGAACGGAGGCCCGTTTATGAGCAAGCAAGATAT
  5   1   3        nb Limb      in                        CBSU5607.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGANAAGAACAGAAGAGAAAC
  5   1   2       ext Ski1      in                         CABJ3558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACG
  5   1   3        nb Limb      in                       CBSU10135.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATTATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCCCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACA
  5   1   3        nb AbdN                               IMAGE:7006543                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGANAAGAACAGAAGAGAAACGGAGGCCCGGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAAACGTCCCTTCAGGGATTGGGAGATAGAGCTTCAGTCACAGCTGGCGAT
  5   1   3        nb AbdN      in                       IMAGE:6998603                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTNTATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGNCAGTAC
  5   1   2       ext Ski1      in                         CABJ1213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGTGGAGGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGANAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGGATGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAAACATCATTGG
  5   1   3        nb Limb      in                        CBSU6130.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTTGGAGGAGGATTTGGTGGAAGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAAGTTAAAGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGANAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCATAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCA
  5   1   3        nb Ski1                                CABJ12185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGG
  5   1   2       ext Ski1      in                          CABJ985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCTGGTGGTGGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGG
  5   1   4      seed Ski1      in                        CABJ10526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGANACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAAC
  5   1   3        nb Ski1      in                         CABJ1729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATT
  5   1   3        nb Limb      in                        CBSU4715.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCGGTGGAGGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATTATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCCCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAAC
  5   1   3        nb Limb      in                        CBSU3942.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATACCGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATTATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTATAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGA
  5   1   3        nb Ski1      in                         CABJ3440.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCTGGCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGANACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGG
  5   1   3        nb Limb      in                        CBSU1777.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGGGGATTCGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTT
  5   1   3        nb Ski1      in                         CABJ4663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGAGGAGGATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGANACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAG
  5   1   3        nb Ski1      in                        CABJ11548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTGGTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGA
  5   1   3        nb Ski1      in                         CABJ2943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGAGGATTTGGTGGCAGAGGACCTGGTGGCTTCGAAGGCCTTCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGNGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGNAGCT
  5   1   3        nb Limb      in                        CBSU9630.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGANACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGC
  5   1   3        nb Limb      in                        CBSU3044.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCTGGTGGCTTCGAAGGCCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGANAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCANAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGANACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCAT
  5   1   3        nb Ski1      in                         CABJ3313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCGATTCGGGCAACCATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAAGCACGAGTACAAACAGCTGCT
  5   1   3        nb Limb      in                        CBSU6478.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTCCTGGCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATTATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCCCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGNCAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAA
  5   1   3        nb Ski1      in                         CABJ4806.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAACCAATGAAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGNGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGA
  5   1   3        nb Ski1      in                        CABJ12244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTT
  5   1   3        nb Ski1      in                        CABJ11915.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGCATACCATGCAAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGNGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATNCAG
  3  -1   3        nb Ski1      in                         CABJ1606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGANACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGNGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAAGCACGAGTACAAACAGCTGCTGGACATCAAGACCCGGGTAGA
  5   1   3        nb Ski1      in                         CABJ2714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAACCTTAACGACCGCTTAGCCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGNGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCA
  5   1   3        nb Ski1      in                        CABJ10773.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAATTACCTGGATAAGGTTAAGGCTTTGGAAACCGATAATAACGATCTTGAAAAGAAAATACGAGAGTGGTATGAAAAACTTCGCCCTGAATCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGNGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACTAACAGCTGCTGGACATNCAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGA
  5   1   3        nb Ski1      in                         CABJ8804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGA
  5   1   3        nb Limb      in                        CBSU3080.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAGATCTCAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGG
  5   1   3        nb Limb                                CBSU6709.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGNACATCAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGG
  5  -1   3        nb Ski1      in                         CABJ1606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCCAGAGCGTGGAGCCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTACTTTCCTTTCCAACATTCTG
  3   1   3        nb Ski1      in                         CABJ2943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATTTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAG
  3   1   2       ext Ski1      in                          CABJ985.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCCTTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAA
  3   1   4      seed Ski1      in                        CABJ10526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTGNACTGAGAAACTGGCGTATCTGAAGAAAAATCATAAGAGGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAAAAA
  3   1   3        nb Ski1      in                         CABJ3313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTACTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAG
  3   1   3        nb Ski1      in                        CABJ11548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAGGCTGATCTGGAATTGCAGATGAAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGC
  3   1   2       ext Ski1      in                         CABJ3558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGGTTTGGCATACTCGCT
  3   1   3        nb AbdN      in                       IMAGE:6998603                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGGAATGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGANGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGTGGGACCTGCTGGCCAGCTCACTGTGNAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTATAAGTGCCCN
  3   1   3        nb Ski1      in                        CABJ11915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTGCAGATGAAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Ski1      in                         CABJ2714.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAAGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Ski1      in                        CABJ10773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTACTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Ski1      in                         CABJ8804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTCCGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAACGTGATTTCTTCGAGCGTCCG
  3   1   3        nb Ski1      in                         CABJ1729.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Ski1      in                         CABJ3440.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Ski1      in                         CABJ4806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Ski1      in                        CABJ12244.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGNGTTTGGCATACTCGC
  3   1   2       ext Ski1      in                        CABJ10250.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTC
  5  -1   2       add Ski1      in                         CABJ9597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTCACCTTAGGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAAAAAA
  3   1   3        nb Limb      in                        CBSU3044.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTC
  3   1   2       ext Ski1      in                         CABJ1213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCC
  3   1   3        nb Ski1      in                         CABJ4663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGC
  3   1   3        nb Limb      in                        CBSU5607.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTC
  3   1   3        nb Limb      in                        CBSU1777.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCACTGTGNAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTC
  3   1   3        nb Limb      in                        CBSU9630.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTTTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTTTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb      in                        CBSU4715.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCG
  3   1   3        nb Limb      in                        CBSU3942.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTATAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCC
  3   1   3        nb Limb      in                       CBSU10135.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb      in                        CBSU3080.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb      in                        CBSU6130.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb                                CBSU5000.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCGGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb 5x3  out                       CBSU6230.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATTTCAGATTTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTTTGTTTTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATTTCCCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTTTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTTTTCGAGCGTCCGCGAAATCGGGGGGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTTTGCAGAGTTTTTACCTTTTTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTTTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTACTTTTTT
  5   1   3        nb Limb      in                        CBSU5595.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb      in                        CBSU5595.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb      in                        CBSU6478.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATGNGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGGTTTGGCATACTCGCC
  5   1   3        nb Limb      in                        CBSU2645.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb      in                        CBSU2645.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  5   1   3        nb Limb      in                        CBSU2572.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   3        nb Limb      in                        CBSU2572.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGCAAGTTGCTGGAAGGAGAGGGAGGAAAACTGCTAGCTGGGATGTCAGATGGAAAAACTCCTTCAGATTCTTCCAAAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTGGGCATACTCGCT
  5   1   2                                           Xt7.1-CABJ1736.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTATAGGGCGAGAGCCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTTAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGG
                                                  Xt7.1-CHK-1008278572                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCGAGAGCCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTTAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACT
  3  -1   2       ext Ski1      in                         CABJ1736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTATAGGGCGAGAGCCCGGCGGTGTGGGAACCGTAGACTACAGTAAATACTTACCAATAATTGAAGATCTTAGGAAAAAGATTATGGAAAGCACTTTGGAAAATGCCAAGATTCTCTTACAGACTGACAATGCCCGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAATGGCCTACGTAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGA
  5   1   4      seed Bone      in                       CBTC10745.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAGTATGAGAATGAGCTGGCCCTTCGCCAGAGCGTGGAAGCCGATATTAACGGCCTACGGAGAGTGCTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACCGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGA
  5  -1   2       ext Ski1      in                         CABJ1736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGATGAGCTGACCCTGTGCAAGGCTGATCTGGAATTGCAGATTGAAAGCTTGACTGAGGAACTGGCGTATCTGAAGAAAAATCATAAGGAGGAACTGGATGCTCTACGAGGTGGACCTGCTGGCCAGCTCACTGTTGAGATGAATGCGGCTCCAGCAGTTGACCTGACCAAGTTACTCAATGACATGAGGGAGCAATATGAAACCCTGGCTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGC
  3   1   4      seed Bone      in                       CBTC10745.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAAAAGAACAGAAGAGAAACGGAGGCCCGGTTTAATGAGCAGAGCAAAGATATAAAGAAAGAAATCTTAGCTGGAGTGCAGCAAGTACAGTCCAACACTACAGAGATCTCAGATCTGAAACGGTCCCTTCAGGGATTGGAGATAGAGCTTCAGTCACAGCTGGCGATGAAACAATCATTGGAGAAAACCCTGGCAGAAACGGAAGGACGCTTCTGTTCTCAGCTTGGGCAGCTACAGAACTTAATCACAAGTGTGGAGGAGCAGCTGTTCCAACTGAGAAATGACATGGAGCTTCAGAGCAACGAGTACAAACAGCTGCTGGACATCAAGACCCGGTTAGAGCAGGAGATAGAGACATATCGCAAGTTGCTGGAAGGAGAGGGAGGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  5   1   2  SIG                                     Xt7.1-CBSU10011.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGTGTAGGACTGGCCAGACCGGGGGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGAGTGAGTGTAGGACAGGCCAGACCGGGGGGAGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGAGTGAGTGTAGGACTGGCCAGACCGGGGGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTTAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGACTGTGACGTAGTTGGCTGGCTTGAATAAAACACCTTCGGACATGCACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGGGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGAACTTTACAATAGTTTACCTTTAGAGTCTTGGCATTGTATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCTCATGGTCCTCAACCCAACATTTTTAAAGATCCATCATGGTTGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGC
                                                  Xt7.1-CHK-1008278574                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGGACTGGCCAGACCGGGGGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGAGTGAGTGTAGGACAGGCCAGACCGGGGGGAGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGAGTGAGTGTAGGACTGGCCAGACCGGGGGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTTAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGACTGTGACGTAGTTGGCTGGCTTGAATAAAACACCTTCGGACATGCACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGGGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGAACTTTACAATAGTTTACCTTTAGAGTCTTGGCATTGTATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCTCATGGTCCTCAACCCAACATTTTTAAAGATCCATCATGGTTGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTC
  5   1   4      seed Limb      in                       CBSU10011.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAGTGTAGGACTGGCCAGACCGGGGGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGAGTGAGTGTAGGACAGGCCAGACCGGGGGGAGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGAGTGAGTGTAGGACTGGCCAGACCGGGGGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTTAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGACTGTGACGTAGTTGGCTGGCTTGAATAAAACACCTTCGGACATGCACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGGGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGAACTTTACAATAGTTTACCTTTAGAGTCTTGGCATTGTATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCTCATGGTCCTCAACCCAACATTTTTAAAGATCCATCATGGTTGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAAGTGAACGGAAAAGTGATTTCTTCGAGC
  3   1   4      seed Limb      in                       CBSU10011.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACCGGGTGTGAGTGAGTGTAGGACTGGCCAGACTGGGGGTGACTGTGACGTAGTTGGCTGGCTTGAATAAAACACCTTCGGACATGCACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGGGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGAACTTTACAATAGTTTACCTTTAGAGTCTTGGCATTGTATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCTCATGGTCCTCAACCCAACATTTTTAAAGATCCATCATGGTTGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   2       add Ski1      in                        CABJ10890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTGAGTGTAGGACTGGCCAGACTGGGGGTGACTGTGACGTAGTTGGCCGGCTTGAATAAAACACCTTCGGACATGCACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGTGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGACCTTTACAATAATTTACCTTTAGTTGACCACCTTTAGAGTTTTGGCATTATATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCACATGTTCCTCAACCCAACATTTTTAAAGATCCATCATGGTGGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  5   1   2       add Ski1      in                        CABJ10890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTGAGTGTAGGACTGGCCAGACTGGGGGTGACTGTGACGTAGTTGGCCGGCTTGAATAAAACACCTTCGGACATGCACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGTGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGACCTTTACAATAATTTACCTTTAGTTGACCACCTTTAGAGTTTTGGCATTATATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCACATGTTCCTCAACCCAACATTTTTAAAGATCCATCATGGTGGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGAACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGAGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCTAAAAAAAAAAAAAAAAAA
  5   1   2       ext Limb      in                        CBSU9527.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGGGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGAACTTTACAATAGTTTACCTTTAGAGTCTTGGCATTGTATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCTCATGGTCCTCAACCCAACATTTTTAAAGATCCATCATGGTTGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT
  3   1   2       ext Limb      in                        CBSU9527.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACACCCAGGCACCTTGTATCACATTAAATAAGGACTGCAGATGTAAAGCTTTGGGAGAAAATGTTCGGAATTCTGGGTACAAACATGACAGTTTGTGTTAATAGTTGAACTTTACAATAGTTTACCTTTAGAGTCTTGGCATTGTATGAAATGTGAATTCTCACTCTTAACCCACCCCACTATACAGTTTGTTTTTATTTTTTCATAAAGTAGTTTATACATTTCATGATTTTCCTCATGGTCCTCAACCCAACATTTTTAAAGATCCATCATGGTTGGGCGCGTAGGTTACGCAGGTTAGGTTGAAGAGGCAAACTGCTAAACCATTTCTATCACAATAAACAACATATAAAGATTACTTTGTGATTTAGTTGATTTTGTTCAATTTCTCAGATTCATCCAGGACAAGAAGAGTTAAAATGGTCATTGAAGAGGAGGTGAACGGAAAAGTGATTTCTTCGAGCGTCCGCGAAATCGAGGAGAAACACTAGGACCGGCTGGCCAACGAGCTCCTCATTCTGCAGAGTTCTTACCTTTCTGACTCTCGGGCTAATGCTTATTCCCAATGGCAGAACTGCTTTCCTTTCCAACATTCTGCTACAAACACTATAACTATATGCTTAATAAAGGTTTGGCATACTCGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)