Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 179.0    0Xt7.1-IMAGE:7021699.5                      76 PI      73        288      756                RAB5B, member RAS oncogene family [Xenopus tropicalis]
     2 265.0    0Xt7.1-XZG3394.5                            43 PI      75        288      801                RAB5B, member RAS oncogene family [Xenopus tropicalis]
     3 362.0    0Xt7.1-TTbA074a04.5                         19 PI      80        328      790                RAB5C, member RAS oncogene family [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012071080 Xt7.1-XZG33080.5 - 173 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG33080.5                AATTGTGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACCA
                                                  Xt7.1-CHK-1008222071                      GACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTT
                                                      consensus depths                     4     6    18    22    23    27    35    42    44    47    54    57    55    58    57    59    57    59    61    62    61    62    61    62    61    62    61    62    61    62    61    62    61    62    62    63    61    63    62    63    61    63    60    63    60    64    61    64    61    64    61    63    60    64    65    67    66    69    66    69    64    70    65    69    65    70    65    70    64    70    65    71    66    71    66    73    69    74    68    74    71    75    71    76    72    77    71    76    72    77    71    76    74    78    72    78    76    80    78    81    78    82    78    81    76    80    76    80    72    77    71    77    68    76    66    71    67    71    66    70    64    68    64    68    62    66    61    66    60    64    48    59    50    57    47    53    45    51    45    51    42    49    43    47    44    50    46    50    40    46    39    46    40    45    39    43    36    38    36    38    36    38    37    39    38    41    39    41    38    41    37    41    40    42    40    42    40    40    40    41    40    40    38    41    38    43    39    45    41    45    39    46    41    47    40    45    40    45    41    46    40    49    38    48    43    49    45    49    46    50    48    52    51    54    49    53    49    54    46    53    47    54    36    40    41    44    41    43    42    44    43    45    43    45    42    44    41    45    45    46    49    52    52    53    53    56    53    56    53    56    54    59    54    58    54    57    54    57    55    58    56    57    56    59    54    57    54    57    53    57    54    57    52    56    53    56    53    56    52    55    52    55    52    55    53    57    55    59    56    62    59    64    59    64    60    64    59    63    59    63    60    65    61    66    59    64    59    64    58    63    57    61    56    60    56    60    57    60    56    59    57    58    56    57    47    49    45    46    44    45    44    44    44    44    43    44    44    44    43    44    43    44    42    44    41    43    40    42    40    42    38    41    38    40    38    40    35    39    27    37    10    26
                                                                   SNP                                                    C-----------
                                                                   SNP                                                                                                                                                                                                                                        ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------GC--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------T-
                                               BLH ATG     237    1161                
                                               BLH MIN     237     128                
                                               BLH MPR     210     128                
                                               BLH OVR     237      91                
                                               CDS MIN     237     128                
                                               EST CLI       4      34                
                                               ORF LNG     237       3                
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bb ---= 2e-016     BAE95627.1 GTP binding protein Rho [Branchiostoma belcheri] =================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Br ---- 6e-021     ABB85359.1 Ran [Branchiostoma belcheri tsingtaunese] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---= 3e-037     BAC57527.1 GTP-binding protein rab-2 homologue [Ciona intestinalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Sc ==== 3e-052     NP_014732.1 Rab5-like GTPase involved in vacuolar protein sorting and endocytosis postvesicle internalization; geranylgeranylated; geranylgeranylation required formembrane association; Vps21p [Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 4e-082     NP_523457.1 Rab-protein 5 CG3664-PE [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PROTEIN === Ce ==== 2e-086     NP_492481.1 RAB family RAB-5 (22.8 kD) (rab-5) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 2e-095     XP_783878.1 PREDICTED: similar to Ras-related protein Rab-5C (RAB5L) (L1880) [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 1e-110     NP_004153.2 RAB5A, member RAS oncogene family; RAS-associated protein RAB5A [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 2e-111     NP_001006363.1 similar to GTP-binding protein Rab5 - dog [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 2e-111     NP_080163.1 RAB5A, member RAS oncogene family [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 5e-113     XP_702510.1 PREDICTED: hypothetical protein XP_697418 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xl ==== 7e-119     AAH43866.1 Similar to RAB5A, member RAS oncogene family [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 7e-119     NP_001080535.1 RAB5A, member RAS oncogene family [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 3e-120     AAH80959.1 MGC79690 protein [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG33080.5                                                                                                                   TGA------------------------------------------------------TAA------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TAA---------------------------ATG------------------------TAATAA------------TAA------------------------------------ATG---------------------TGA------TAA------------------TAATAA------------------------------------------------------------------------------ATG------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TAA------------------TAA------------------------------------------------------------------------------------------------------------------------TGA------TAA------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TAA------ATG---------TAA------TAG---------------------------------------------------------------------------TAA---------------------ATG---------------------------ATG------ATG------------------TAA---------------ATG---TAA---ATG------------------------TAA---------------------------TAG---TGA---------------------------------------------------TAA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   1           Tbd0 FL                     IMAGE:6980837.FL-MGC                                                   CAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTTCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           TpA  FL                     TTpA008a18.FL-Sanger                                                                                                                        AAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATG
  5   1   2   12  bld Gas7 5g3  in                         XZG56990.5p CGGACGCGTGGGCGGACGCGTGGGGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTNCAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCA
  5   1   2       bld In66 5g                         IMAGE:8965865.5p    GTAGCTTAACTACCATATTCAAAAAAAAAAAAAAACCGCAGGAACCAAGAAGCTGGACGTTAACGGCGCTTGTTGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCTCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAGCTTCCCAGACGGAACCACAGGCTGGAGGAGCCACACCATCAGAGAGAGGAGTAGACCTTACTGAACAGCACACCTACCAAAGTCAATGCTGTAGTAACTACCTAAGGCTCCTTGGTCTTGAACCTGGAATGATATTATCTTTGCCTCCTTAAGTGATAAT
  5   1   2       chi 1030 5x                         IMAGE:7026001.5p     GGCGAGATGAGAATTGTGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAAGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCATAAAGGGACAGTTTCACGAATTCGAAGAGAAGCACAATTGGAGCTGCTTTCCCTTTTCCCAACAGGCTGTTCTCGATGATACAACGGTAAAATTTGAGATTTGGGAAACAATCTGGTCAAGTAGAGGTAATAAAAGCTCTGGGCCACCAAGGAACCAATAGTGGGGAAGCCCCCAAGGCTTGGAAAATAAATATGTAACTTCTGAACCATTTTTCCAAAATTGTATAGGAAAATCCAATTTTTGGACTTAAGGAATTCACAAAAAAAACAACTGGTGGGGGCAAAATGCTAGGATATACCTGTTCTCATAGTATGAACTCGTGGGGGTCAGTGGCTGTAGTCTCCACACGTGTAATTCGTTGGGGTTATGAGACCCTATNATATACGCTGGGTGTGAGAAAGTCATAGTAATCTGAGAAAACCTAGGAGAACGCCCTCCAAAAAGACATGGGAAACCCGGTGTTGTGACAATTTTATATCAGAAGAGGATAGAAGACTCCAACAAAGTTTTGTATGTGTGTCGTGGCAATGATGATCACAAACACTCGCCCACGGTACGTAGGTGTTGCGATGGCGAGGAGCAACTGCGTCGGGGGGCTGACAAGAAAGTACATAATCATGGTGTGAGTTGAGCTGGAAAATGTCGAACTAATTTGTTTTCGAATGGGTTTGTGTTTGAG
  5   1   2   22  bld Gas7 5g                              XZG61308.5p ............GAGAATTGTGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGCTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAAGCACACCAT
  5   1   2   12  bld Gas7 5g3  in                         XZG23500.5p ..............GAATTGTGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG33080.5p ..............GAATTGTGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAAGCACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTNCATGCTGTAGTAACTAAACTAAGGCT
  5   1   2       bld Neu0 5g                            IMAGE:6996119                    GTGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTNGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTTCCCAAGAACGGAACCACAGGGCTGGGAAGGAAAGCAACACCCTTCGAAGGGAAGAGGGAGTAAAAACCTTACTTGAAAACAGCACCAACCCTACCCAAAAGGTCAAATGCCTGGTAGTTAACCTTAACCTTAAGGGGCC
  5   1   2       bld Neu  5g                        TNeu009i02.p1kSP6                    TGACGTCGGGATTAGCTGTCCGGCAGGGAACCAANAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCAAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTGAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGNGAGCCCAAGCTGCAATAGTTGTATATGACAT
  5   1   2   12  bld Gas7 5g3  in                         XZG23653.5p ...................GTGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTA
  5   1   2   20  bld Thy1 5g   ?                         CBST5389.fwd ...................GTGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTT
  5   1   2       bld Egg  5g3  in                   TEgg046n10.p1kSP6                     TGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAG
  5   1   2       bld Neu  5g                        TNeu082p07.p1cSP6                     TGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGC
  5   1   2       bld Neu  5g                        TNeu144g08.p1cSP6                     TGACGTCGGGATTATCTGTCCGGCAGGAACCAAGAAGCTGGGCGTTAACGGCGTTGCGGGACGTTTAATCATCGATCCGGGAGCCCGGGCTGTGTGATGAAATCGGCTCTGTCCCGCGAATATCGGGCCTGTTTGGCGATTGCCATAATGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCATCCGACGGTGTAATCATCATACGTGTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCATACCGAATGGGCCGAATGCAGGAAATAAAATCTGTGAGTGTAAACTTGTGCTTTTATGAGAATCCGCAGTTGGAAAGTCTATTCTATTGCTTCGCTTCGTAAATGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCGTTCCTTACCCAAACAGTGCTGGCTCGATGATACAACTGGAAAATTTGAAATTTGGGATAC
  5   1   2       bld Gas  5g                        TGas015g12.p1kSP6                     TGACGTCGGGATTAGCTGTCCGGCAGGAACCAANAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGCTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTNTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCT
  5   1   2   14  bld Brn3 5g3  in                         CAAK8481.5p ....................TGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAGACGGAACCACAGGCTGGA
  5   1   2   14  bld Brn3 5g3  in                         CAAK9899.5p ....................TGACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCAAGACGGAAC
  5   1   2       bld Tbd0 5g                            IMAGE:6979849                       CCCGGGATATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGAACACAGCTTTATGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGA
  5   1   2       bld Gas  5g                        TGas026b08.p1kSP6                       ACGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGCTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTNTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATNNTCAAGAAGCTCAAGCTTA
  5   1   2   12 seed Tad5 5g3  in                         XZT30028.5p .......................CGTCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTAC
  5   1   2       bld Egg  5g3  in                   TEgg016g05.p1kSP6                          TCGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCT
  5   1   2       bld Egg  5g                        TEgg089m23.p1kSP6                          AGAGGTATTGTTGACCCGGACGAACCAATAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAGGCATCGATCCGGGAGCCCGGGCTGTGTGATGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTT
  5   1   2       bld Egg  5g3  in                   TEgg066p13.p1kSP6                           CGGGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGA
  5   1   2   14  bld Te5  5g3  in                         CAAO6711.5p ............................GGATTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCNTAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCCAGAC
  5   1   2       bld Gas  5g                        TGas143g08.p1kSP6                               GGTAGCTGTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTG
  5   1   2   12  bld Gas7 5g3  in                         XZG27402.5p .................................CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGCTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGCCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAAACTGGGTAAAAGAGCTGCCGAGACAGGCAACCCCCC
  5   1   2       bld TpA  5g3  in                   TTpA055c20.p1kSP6                                     CTGTCCGGCAGGAACAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCANAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGGCCTCA
  5   1   2       bld Gas8 5g3  in                          st28n02.5p                                      GTCCGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAG
  5   1   2       bld Egg  5g                        TEgg114p13.p1kSP6                                         CGGCAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAA
  5   1   2   14  bld Te5  5g3  in                        CAAO11256.5p ...........................................CAGGAACCCAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGAC
  5   1   2       bld Te5                                  CAAO2706.5p                                            CAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGANATAAAATCTGTCAGTT
  5   1   2   14  bld Te5  5g3  in                         CAAO6508.5p ...........................................CAGGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAAGCACACCATCAGAGGAAGAGGAGTAGACCTTTACTGAACAGCACAACCTACCCAAAGTCAATGCTGTAGTAACTAACTAAAGGCT
  5   1   2       bld HdA  5g3  in                   THdA003a01.p1kSP6                                             CAGGAACAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTTCAGAAGCTCAAGCTTACGCAGATGAACACAGCTTATTGTTCATGG
  5   1   2       bld Gas1 5g                            IMAGE:6986363                                              GGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCANGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACCGAACCACAGGCTGGAGGAAGCACACCATCAGAAGAAGAGGAGTAGACCTAC
  5   1   2   12  bld Gas7 5g3  in                         XZG58301.5p .............................................GGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGCTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCCAAGACG
  5   1   2   10  bld Eye  5g3  in                         CCAX2195.b1 .............................................GGAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAG
  5   1   2   14  bld Te5  5g3  in                          CAAO575.5p ..............................................GAACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAGACGGAACCACAGGCTGGAGGAAGC
  5   1   2       bld TbA  5g3  in                   TTbA047g06.p1kSP6                                                AACCAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTATAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTA
  5   1   2       bld HdA  5g3  in                   THdA052o15.p1kSP6                                                GAACAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGGCTGGAGGAAGCAACACCATCAGAGGGAGGAGGAGTAGACCTTACTGANACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTG
  5   1   2       bld TpA  5g                       TTpA022i01.p1kaSP6                                                 AACCAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTANAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAA
  5   1   2       bld Tbd0 FL                            IMAGE:6980837                                                   TCAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTTCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCNTAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTTTCCAGACGGAACACAGGCTGGNAGAGCACN
  5   1   2       bld TbA  5g                        TTbA046b23.p1kSP6                                                   CAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGAACTTGTAATCATCAGAACGTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTTCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTCGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGAC
  5   1   2       bld TbA  5g3  in                   TTbA046c05.p1kSP6                                                   CAAGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTNCAGAAGCTCAAGCTTACGCAGATGAACACAGCTTATTGTTCA
  5   1   2       bld Gas8 5g3  in                          st29n02.5p                                                     AGAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACT
  5   1   2       bld Tbd0 5g                            IMAGE:6980404                                                      GAAGCTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCAA
  5   1   2   12  bld Tad5 5g3  in                         XZT28540.5p .........................................................CTGGACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCA
  5   1   2   14  bld Brn3 5g3  in                        CAAK12950.5p ............................................................GACGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTNGAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTTAACTGTATGGATATTATCCTG
  5   1   2       bld Te5                                  CAAO4929.5p                                                               CGTTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAAGCACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAG
  5   1   2       bld Gas  5g                        TGas025l13.p1kSP6                                                                 TTAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATG
  5   1   2       bld Gas8 5g3  in                          st48p12.5p                                                                 GTTACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGANCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTANGANAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACANATGAGGAATCATTTGCTANAGCANAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGA
  5   1   2       bld 1030 5g                         IMAGE:7093389.5p                                                                  GAACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAGAGAGCTGTGGANTTTTCAGAAGCTN
  5   1   2   12  bld Gas7 5g3  in                         XZG37774.5p ..................................................................AACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGCTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCCCAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCT
  5   1   2       bld TpA  5g3  in                   TTpA058k08.p1kSP6                                                                    TTACGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAAGCACACCATCAGAGGAAGAGGAGTAGACCTTACTGANACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGC
  5   1   2   12  bld Gas7 5g3  in                         XZG22868.5p ....................................................................CGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTTGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCA
  5   1   2       bld Gas8 5g3  in                          st48o10.5p                                                                     CGGCGTTGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAAT
  5   1   2   10  bld Ova1 5g3  in                        CABE11906.5p ..........................................................................TGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGC
  5   1   2   10  bld Mus1 5g3  in                         CABH2057.5p ..........................................................................CATCGATTCGTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCCAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTTCTTGTCTTTAAACTGTATGGATATTATCTTGCTTCCTAT
  5   1   2   11  bld Eye  5g3  in                         CCAX3489.b1 ..........................................................................TGCGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAAAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCCCGAAT
  5   1   2       bld Egg  5g3  in                   TEgg042p09.p1kSP6                                                                             CGGGACGTTTAAGCAGCGATCCGGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATT
  5   1   2       bld HdA  5g3  in                   THdA007n01.p1kSP6                                                                                                  CTGGAGCCCGGGCTGTGTGAGGAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCACTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCCAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTACAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAACTTTATCTGGTAACAAAGCTGATCTGGCCTCAAGAGAGCTGTGGATTTTCAAGAAGCTACAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTTAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAA
  5   1   2       bld TbA  5g3  in                   TTbA016k20.p1kSP6                                                                                                                       GAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTTCCCAGACGGAACCACAGGCTGGA
  5   1   2   34  bld Te3  5g                               CAAM430.5p ......................................................................................................................GAAATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAANAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCANAAGTCAATGCTGTAGTAACTAACTAAAGGCTTTCTGTCTTTAAACTGTATGGATATTATCTTGCTTCCCTAATTGT
  5   1   2       bld TpA  FL                        TTpA008a18.p1kSP6                                                                                                                         AATCGGCTCTGTCCCGCGAAGAGCGGGCCTGTTTGGCGATTGCCAGAAGGATAAGTGAGCATCCAACCCACCCTTTGCTTATTGGGCTGCAGCCGACTTTGTAATCATCAGACGTTTTGCCTACAATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGG
  5   1   2   32  bld Gas7 5g                              XZG10689.5p .................................................................................................................................................................................................................GAGCCGACTTTGTAATCATCAGACGCTTTGCCTACNATCAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAA
  5   1   2       bld HdA       in                   THdA045m13.p1kSP6                                                                                                                                                                                                                                                                               AGCTACCAGACCGAATGGACCGAATGCAGGAAATAAAATCTGTCAGTTTAACTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGNTGAAGTATGTTAAACTANGCCCTGTGAAACTAATA
  5   1   2       bld Tad5      in                         XZT37736.5p                                                                                                                                                                                                                                                                                                                                  CTTGTCCTTTTAGGAGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCTTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGT
  5   1   2       bld HdA                            THdA004l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                AGAATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATC
  3   1   2       bld Te5  5g3  in                        CAAO11256.3p                                                                                                                                                                                                                                                                                                                                                   ATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCAT
  5   1   2       bld Gas7                                 XZG49815.5p                                                                                                                                                                                                                                                                                                                                                   ATCCGCAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCT
  5   1   2       bld Gas                            TGas111l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                        CAGTTGGAAAGTCTAGTCTAGTGCTTCGCTTCGTAAAGGGACAGTTTCACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGA
  5   1   2       bld HdA       out                 THdA040h09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                          TGGGAAGGTCTGTTCTACTGCTTCTCTTCATAAACGGAGAGTTTCACGATTTCCGCGAGAGCGCACTTGGATCTGCTTTCCTTACCCAAACAGTCTGTCTCGTATGATACAACTGTTCAATTTGAAATTTGGGATACTGCTGGCCAAGAGAGGTATCACAGCTTGGCCCCAATGTGCTACTCGGGAGCCCAAGCTGCTATAGTTGTATATGACATTACTAATGACGAATCATTTGCTATAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCATAGAGAGCTGTGGATTTTCAATAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTAT
  5   1   2       chi Tad5      in                         XZT35459.5p                                                                                                                                                                                                                                                                                                                                                                                CCAAAATGTTAGGATCCCCAAGTAAAATCAGTGCTTAAGTTTTTTGCATGTGTGTATAAACCTTATATAATTTTATGATTTACTAAGATGGAGTTGCTCTCTCTCTTCCCCCTATACTATATTCTGTAAGCATCAGCACAATTGTGTAGGTGGGACAGGCTTAGTTTATTCAACTTCACTCACTCTTTTTTTTTTATTTACAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGT
  5   1   2       bld Tad5      in                         XZT72722.5p                                                                                                                                                                                                                                                                                                                                                                                                        ACGAATTCCAAGAGAGCACAATTGGAGCTGCTTTCCTTACCCAAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGT
  5   1   2       bld Gas7      in                         XZG33873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACAGTCTGTCTCGATGATACAACTGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGG
  3   1   2       bld Egg  5g3  in                    TEgg042p09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGATACAACTGTAAAATTGNAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGATGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGNGAACTTTTAAAACTTTTGTTTTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg046n10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGATACAACTGTAAAATTGNAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTAAAACTT
  3   1   2       bld Egg  5g3  in                    TEgg066p13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGAAATTTGGGATACAGCTGGTCAAGAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAGAGTGGAACTTTTAAAACTTTTTTTTTCTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu031f23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAATCCCGGGNAGNANAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTNTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAG
  3   1   2       bld HdA  5g3  in                    THdA052o15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAGGTATCACAGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTTTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGCAGCTTTTAAAACTTTATTCTTGTCAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas7 5g3  in                         XZG58301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCTTGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCNCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCT
  3   1   2       bld Tad5 5g3  in                         XZT30028.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCCCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCT
  5   1   2       bld Tad5      in                         XZT43308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGACGCGTGGGGTTGTATATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAANAA
  3   1   2       bld Gas8 5g3  in                          st28n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGACATTACAAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCGTGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTAT
  3   1   2       bld Gas7      in                         XZG33873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCT
  3   1   2       bld Gas8 5g3  in                          st29n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATGAGGAATCATTTGCTAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCGTGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGGACAATAGCC
  3   1   2       bld Gas7 5g3  in                         XZG23500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCT
  5   1   2       bld Egg0                                 dad74g09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATA
  3   1   2       bld Te5  5g3  in                         CAAO6508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCT
  3   1   2       bld Te5  5g3  in                         CAAO6711.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAG
  3   1   2       bld Gas8 5g3  in                          st48o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTG
  3   1   2       bld Gas7 5g3  in                         XZG27402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAGCTTTATCTGGTAACAAAGCTGATCTGGCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACCCCTTCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTCCAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTTTCAGATGCAGGCCCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCT
  3   1   2       bld Eye  5g3  in                         CCAX2195.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCCTCAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTTTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTA
  5   1   2       bld Liv1      in                         CAAR8730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTCAAGAAGCTCAAGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCCAAATCACCTTCTCNCAAATCCAGCTCTACATTCC
  5   1   2       bld Tad5      in                         XZT25606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTNATAATTTATAGCTTGTTAGCCACTAATTCCTCCCGCTTTCTCAGATGAGACCGATAAACA
  5   1   2       bld TpA                            TTpA035i03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTTCTGCTAAGACATCAGTGAATGTGAATGAGATATTCATGGCTATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTA
  5   1   2       bld Neu                            TNeu039a19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGCATGGCTATAGCTAAAAACTTCCCAAGNAGGGAACCACAGGGCTGGAGAAGCAACACCATCAGNAGGAAGAGGAAGTAGACCCTTACTGGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAA
  5   1   2       bld Spl2      in                         CBSS519.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACAGGCTGGAGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATNAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAG
  5   1   2       bld Gas7                                 XZG13603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCACACCATCAGAGGAAGAGGAGTAGACCTTACTGAAACAGCACAACCTACCAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACNAGTACCGAGAATCGTGTTTTACACTGATCAATTCTATTTCAGTTGATTAGCGTGCAAAGCCATTTTTATTATCC
  3   1   2       bld Te5       in                         CAAO6361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAAAGTCAATGCGGGGGTAACTAACTAAAGGCTTTTTGTTTTTTAAACGGGAGGGATATTTTCTGGCTTCCCAATTGTTAAAAACAATTTAGGGTTTAATCCCTTTTTGGCCTGGGGGCCCCCCCTTTTAGGGCAATGCTTTGCAAGCCCCCCTGGCGGGGGGTTTTTTAAACTGGGCCCCGGGAAAACTAATAAAGGGGGGCTTCCCGGGGGGTTTCCTCCATAAAACAGGGTTTTTTTACCGCTAATTTTGATTTTTTTTTTTTAACCGGCCCCCCTTTTTTTTTCCAAGCTTTTTTCCGTGGGGGGGAATAGGCCGGGGTTTTTTACAGAGCTTTTTCAGATGCGGGCCCTTGGGGGGAACAATTTGGGTTTTTGCAAACCCTTGCAAATTTTGGGGGGCAAAGGAGAAAGGGTTTTTTTTTTTGGGGGCCAATTGCCCCAAAGGGGAACTTTTAAAACTTTTGTTTTTTT
  5   1   2       bld Te5       in                         CAAO6361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTNANaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Liv1      in                         CAAR6176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAAGTCAATGCTGTAGTAACTAACTAAAGGCTTCTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATA
  3   1   2       bld Gas8 5g3  in                          st48p12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTCTNTAAACTGTATGGATANTATCTNGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTACTTGGCCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCANGGCAGNGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGGTATTTTACTGCTAATTCNGATTTTTTCTCNNTAACATGCATGCATTNTGTTNTGCAAGCNGTTCTCAGTGTGNGAGAATAGGCCGG
  5   1   2       bld Tbd0                               IMAGE:6978075                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCGGCTTGGGTACCGGTCCTGGAATTCCNCGGGATTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCTGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTTACCCAATACAAAACAAAAAACTGCAATGTTCTAAATAATGAATGTATACTCAAATTTANGCTATCTTAAAATTGGGATGGGTAAAAATTGATAATGTAAAATTAGGGTACTAA
  5   1   2       bld Gas                            TGas075c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTGGTGCCAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTAT
  5   1   2       bld Gas7                                 XZG11957.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCCCTTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTGAGTATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCCGTTTTACCCAATACAAAAACAAAACTGCAATGTTCTA
  5   1   2       bld Egg       in                   TEgg010p06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCT
  3   1   2       bld Egg       in                    TEgg010p06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGTTAAACTAGGCCCTGTGAAAACTAATAAAGGGAGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCTAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA       in                   TTbA074l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACTTGCCGTGTGGTCTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGA
  5   1   2       bld Tad5      in                         XZT38992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGA
  3   1   2       bld TpA       out                   TTpA035g01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATACATAATACAGAGTTATTTTACTGCTAATTCTGATTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTCCTCTAAAAAAAAAAAAAAAAAAGCG
  5  -1   2       bld Lun1                                 CABD6271.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATACATATACAGAGTATTTTACTGCTATTCTGATTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTAAAACGAATCGATGGATCCGC
  3  -1   2       bld TpA       out                   TTpA058b11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAACATGCATGCATTTATGTTCTCAAGCTGTTCTCATTGTGGGAAAATATGCCGGTGTTTTATACATATCTTTTTCTTATGCATGTACCTTTGGAAAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAAAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGGGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGGGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACCCCAATAACCCACAAATGTTTAGGGGATGAGCTTATTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTA
  3  -1   2       bld TpA       in                    TTpA058b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAACATGCATGCATTATGTTCTACAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAAAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAAAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACCCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTT
  3  -1   2       bld TpA  5g3  in                    TTpA055c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTTTTTTTACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGTCTTTATCAGACTGCCAGGAACCTTGAGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTACCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAACCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCGAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTATTTCTTCATTTTTTATTTTAATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCCATTTAGCTATCTTAAAATTGGATGGTAAAATT
  3   1   2       bld Brn3 5g3  in                        CAAK12950.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTTTTTCTTTTTAACATGCATGCATTATGTTCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCT
  5   1   2       bld Tad5                                 XZT21177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCTACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGATACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTANAATGATAAAAATAAAAAGCTAAT
  3   1   2       bld Tad5      in                         XZT37736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTTTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCT
  3   1   2       bld TbA       in                    TTbA074l24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCTGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTTTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTCCTCTAAAAAAAAAAAAAAAAAAAAAGCGC
  3   1   2       bld Eye  5g3  in                         CCAX3489.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTTCTCAGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTA
  3   1   2       bld Gas7 5g3  in                         XZG33080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTGTGGGAGAATAGGCCGGTGTATTATACAGAGCTTTATCAGATGCAGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTAAAAAAAACC
  5   1   2       bld HdA       in                  THdA018j01.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTATACAGAGCTTTATCAGATGCAAGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAAGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTTATATGTTC
  3   1   2       bld Egg       in                    TEgg065h01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCNAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT72722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGAGCTTTATCAGATGCAGGACCTTGGAGAGAACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTC
  5   1   2       bld Egg       in                   TEgg065h01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGCTTTATCAGATGCAGGACCTTGGAGAGAAAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGT
  5   1   2       bld Egg                            TEgg144b21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGCTTTATCAGATGCAGGACCTTGGAGAGACAATACTGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAATTGGATGGTAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGGTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGGTTTCCTCTATCCCG
  3  -1   2       bld Kid1      in                         CABA6548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGAGAGAACAATACTGGGTCTCTGCAATGCATTGCAAACTTCTGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGTATTACAGNTAAGTGCTA
  3   1   2       bld Egg  5g3  in                    TEgg016g05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATGCATTGCAAACTTCTGGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATA
  3   1   2       bld BrSp      in                     EC2BBA32AD07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTGTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACGAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTA
  5   1   2       bld BrSp      in                     EC2BBA32AD07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGTGCAAAGTAGAAATGGTTATATTATTACGGAGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCCGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTTCGCTTTCTTCACATGAGACC
  3   1   2       bld Gas7 5g3  in                         XZG37774.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGCAAAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATTATAAAAATAAAAAGCTAATGGTTTTTCCTCT
  5  -1   2       bld TpA       in                   TTpA058b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTAGAAATGGTTATATTATTACGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAAATTTAAA
  3   1   2       chi TbA  5x3  out                   TTbA009j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGGCCAACATGAAGCCAAGAAAAAGCCAAATACGAGCACCAGTTTGCCCCATGCACCCCTCACTGTAGCTGTCTCCACGAACCTGCCCATTGGACACTGCATTTATCATTAAAAATGCAACAGTGGCTATCACACCACAAGCATGGTATGAGTGATTCAGATTTTCTGTTTCGGGATAATTAACAGCAGCATCAATGATGATCCACCAGCCTGTAAAGAATAGAACACCAGCTGCAACAGAGGCCACTGTATTTCTTTTCTCGCCCCAATCAATGCATTCTGAGCATCTCAAGTTGTCAAAAAACCCAGACATCTTGTAAAGACCGGCCAATAGTCGCGCTTCCCTGAACACAGTCTCAGTACCAGTTCGCCGATAGAAAGCTTCCTAGCTCTTGCAGAACAACCCGCTTTTTTTTTTTTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTGGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCAGTGGTGAAACGATTTGAGCACTTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCCTTGAAAATGGTATTACAGTTAAGTGCTATTTTGGTGATTGACCCTCCCTAGGGGAAAACAAAAAAAAATCAACCAGAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas7 5g3  in                         XZG22868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACCCTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTTA
  5   1   2       bld Neu                            TNeu025m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAACTTTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATG
  3   1   2       bld Spl1                                 CABK5088.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTAAAACTTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTCAACC
  3   1   2       bld Mus1 5g3  in                         CABH2057.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTGTTTTTCTAAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACC
  5  -1   2       bld Kid1      in                         CABA6548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTG
  3   1   2       bld HdA       in                   THdA018j01.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAGAAAAAGAAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAGATAAATCAAACCGTCGGTAATTTAAACCAGAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TbA  5g3  in                    TTbA016k20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCNGTGGTAATTTCAACCAGAAAAAAAAAATAAAAAAAAAAAAAAAAGC
  3   1   2       bld TbA  5g3  in                    TTbA047g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGAGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTTTAATAATGATGTATACTCAATTTAGCTATTTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTGTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCTTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACTCGTGGTAATTTCAACCAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT38992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAAGAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTNTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACC
  3   1   2       bld Tad5      in                         XZT35459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATTTTTTTAAGCTAATACAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACCAGAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5      in                         XZT25606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATACAAAGCAGGGTATAAAAATCTATTCTCATCTCTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAACCGG
  3   1   2       bld HdA  5g3  in                    THdA003a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTACAGCGTTTGCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTTTAATAATGATGTATACTCAATTTAGCTATTTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTTTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGNGTAATTTAAACCAGAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Brn3 5g3  in                         CAAK9899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCAAAATCACCTTCTCCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTT
  3   1   2       bld HdA  5g3  in                   THdA007n01.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTA
  3   1   2       bld Brn3 5g3  in                         CAAK8481.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTCAACCAG
  3   1   2       bld Ova1 5g3  in                        CABE11906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTC
  3   1   2       bld Gas7 5g3  in                         XZG56990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACGCGTGGTAATTTCAACCAG
  3   1   2       bld Tad5 5g3  in                         XZT28540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTCAACCAG
  3   1   2       bld Tad5      in                         XZT43308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACCAG
  3   1   2       bld Spl2      in                         CBSS519.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACCAG
  3   1   2       bld Liv1      in                         CAAR8730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCCAGCTCTACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACC
  3   1   2       bld TpA  5g3  in                    TTpA058k08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTCCGCTTTTTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTTATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTTTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGGGCCATTTTCACAGAACACCGAACTTTTTCTTTTTTTTTTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTTTAATAATGATGTATACTCAATTTAGCTATTTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTTTACATTTATGTTTAATATGTTTTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTTTATCCCGATTTCCTCCTATGTGGGTTATGGGGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGGTGGTAATTTCACCCCGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld TbA  5g3  in                    TTbA046c05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTCCGCTTATTAATTTATAGCTTGTTAGCCACTAATTCCTTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAANATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAACCAGAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld HdA       in                    THdA045m13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTAATTTATAGCTTGTTAGCCACTAATTCCTTCCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCNACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCCGTGGTAATTTCAAAAAAAAAAAAAAAAAAGCGG
  3   1   2       bld Te5  5g3  in                          CAAO575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTCAACCAG
  3   1   2       bld Gas7                                 XZG29205.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATTATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTCANCCCG
  3   1   2       bld Liv1      in                         CAAR6176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTTTCTTCAGATGAGACCGATAAACAGAATATTGTTTGATTACGCCAATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGAATTTCAACCAG
  3   1   2       bld Gas7 5g3  in                         XZG23653.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAACCCACAAATGTTTAGGGGATGAGCTTAGTTTTTATTTCATAGACAAGTACCGAGAATCGTGTTTAACACTGATCAATTCTATTCAAGGTGATTAGCGTGCAAAGCCATTTTTATTATCCTTTCCAGCGCCATTTTCACAGAACACCGAACTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCAGTTTTTCCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCCCTGTAACAATTCCCTCGCTGTATGTTTTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCCGTGGTAATTTCCCCCGGG
  3   1   2       chi HeRe      in                     EC2CAA10CE08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGATTCTTGGGAGGAGTCTCCTGGGCGGAGGAGTTGACCGCACGGCGGATGGGCATGGTGATATCTGTGGGACCTCCGGAGCCGCTACAACCGAACTGCAGCCTCCAGCTAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTCTTCATTTTTTATTTCTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAA
  5   1   2       chi HeRe      in                     EC2CAA10CE08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATTCTTGGGAGGAGTCTCCTGGGCGGAGGAGTTGACCGCACGGCGGATGGGCATGGTGATATCTGTGGGACCTCCGGAGCCGCTACAACCGAACTGCAGCCTCCAGCTAGCGCCATCTTCACAGAACACCGAACTTTTTCTTTTTTTCTTCATTTTTTATTTCTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg062p07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAACTTTTTCGTTTTTTTCTTCATTTTATATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGAATACTCAATTTAACTATCTTAAAATTGGATGGAAAAATTGTAATGTAAATAAGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATATTGGATAAATTGTACAACTAACTAAAATGATAAAAATAAAAAACTAATGGATTTACCTCTATCCCGATTTCCTCCTATGTAGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCACTGCATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAACATTTGTTAAACAATTATTTTAGCTTTCAAACCTTGAGAATGTATTACAGTTAAATGCTATTTTAGAGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACCAGAACCTGCAAC
  5   1   2       bld Gas7                                 XZG16275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCCTTTTTCTTTTTTTTCTTCATTTTTTATTTTTATATCCANGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTCAACCNGAANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Gas       in                    TGas128e17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTTTTTTTTTTATTTTNTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTCAA
  3   1   2       bld Egg       in                    TEgg062p07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTCATCTTTTATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTTTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTTTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGGGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAATGGTATTACAGTTAAGCGCTATTTTGGTGATTGACATTCAATAAATCAAACCGTGGAATTTAACCAGAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas053h04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAA
  5   1   2       bld Egg                            TEgg088n19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTTTGTTTTGTATTGGGTAAAACTGGATATAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACCAG
  5  -1   2       bld Gas       in                   TGas128e17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTTATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTCAA
  3   1   2       bld Gas       in                    TGas053h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCCAATAAATCAAACCGTGGTGAATTTCAACCAGAAAAAAAAAAAAAAAAAA
  5  -1   2       bld HdA                           THdA025b10.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATCCAGTTTTACCCAATACAAAACAAAAACTGCAATGTTCTAATAATGATGTATACTCAATTTAGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAA
  5   1   2       bld Neu       in                   TNeu068o21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACCAG
  3   1   2       bld Neu       in                   TNeu068o21.q1kT7w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCANATAAATCAAACCGTGNGTAATTTAAACCAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu141p06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTAACCATAGTCTACATTTATGTTTAATATGTTCTGTTACTTGTAAGATTTGGTTAAATTGTACAGTTAACTAAAATGATAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCCGATTTCCTCCTATGTGGCTTATGGCGTTTCATTTACCACTGTAACAATTCACTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTAAGATTTGTTATACAATTATTTTAGCTTTGAAACCTTGAAAAGGTATTACAGTTAAGTGCTATTTTGGTGATTGACACTCAATAAATCAAACCGTGGTAATTTAAACCAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)