Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012071110 Xt7.1-TEgg073a08.3 - 142 ESTs
                                                                       ..-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg073a08.3                                                     GTAGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222433                                                           GAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                          7     9    15    15    17    17    17    17    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    20    20    21    21    22    22    22    22    22    22    21    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    23    23    24    24    24    24    24    24    24    24    24    24    23    24    23    24    23    24    23    24    23    24    23    24    20    22    21    22    21    22    20    21    20    21    20    21    19    21    19    20    18    20    18    20    18    19    17    18    17    18    18    19    18    19    18    19    19    20    19    20    17    19    16    19    17    18    17    18    17    18    14    17     8    10     8     9     8     9     8     9     8     9     7     8     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    11    12    12    12    11    12    12    12    12    12    12    12    11    11    11    11     9    10    10    11    11    12    12    14    12    14    12    13    12    13    11    13    12    13    13    14    14    15    14    16    17    18    17    18    18    19    17    18    17    17    17    17    18    18    17    17    17    17    17    17    17    17    17    17    17    17    17    18    17    18    17    19    17    19    18    19    19    19    19    19    19    19    19    19    19    20    20    20    20    20    20    20    20    20    21    21    21    21    21    21    21    21    21    21    18    18    18    18    16    16    17    17    18    18    18    18    20    20    20    20    20    20    19    19    19    19    18    18    18    18    17    17    17    17    18    18    20    21    20    21    21    21    21    21    21    21    22    22    22    22    22    22    21    21    22    22    22    22    22    22    24    24    23    24    25    26    25    26    25    26    25    26    26    27    27    27    27    27    25    25    25    25    24    24    22    22    23    23    22    22    22    22    22    22    26    31    28    34    28    34    31    37    33    39    32    39    33    40    40    47    42    49    48    51    49    53    53    56    55    58    58    59    61    62    61    62    61    63    62    65    62    66    64    71    66    73    70    74    70    72    69    71    69    71    70    71    69    72    70    72    70    72    69    73    70    72    69    72    68    71    67    71    67    71    68    71    66    71    62    70    67    70    66    69    63    67    64    67    63    67    67    68    65    67    63    67    66    67    64    67    60    66    53    69    52    70    50    70    51    69    49    67    53    67    50    66    54    66    51    66    50    66    52    66    51    64    50    64    50    64    51    65    50    65    50    64    52    63    49    63    48    63    49    63    47    59    42    56    41    53    25    40    14    22     6     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T-----
                                               BLH ATG     285    1175                                                     
                                               BLH MIN     285     204                                                     
                                               BLH MPR     249     204                                                     
                                               BLH OVR     285      36                                                     
                                               CDS MIN     285     204                                                     
                                               EST CLI     -12      30                                                     
                                               ORF LNG     285      13                                                     
                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 4e-173     NP_999896.2 dapper 1 [Danio rerio] ------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 0          NP_067507.2 thymus expressed gene 3; dapper 1 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 0          NP_057735.2 DAPPER1 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 0          NP_001038157.1 dapper 1 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAH77380.1 Dact1 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001083910.1 dapper 1 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          AAY90072.1 DACT1-prov [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TEgg073a08.3                                                                                                                                                                                                                                            TAGTGA---TAA------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------TGA---------------------------------------------------------------------TAA---------TAA------------------------------------------------------------------TAA---------------------------TAA------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------ATG------------ATG------------------ATG---------ATG------ATG---------------------------------TAA------TAG---------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Egg  FL                     TEgg062l20.FL-Sanger                                                      TGGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAAAAAAAAAAAAAAAAA
  5   1   1                FL                     IMAGE:7026526.FL-MGC                                                      CCCGGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCGGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAACGAAAAAAAAAAAAAAA
  5   1   2       bld Egg0 5g                              dad66h05.y1 GTACTCACTNTCCACTTTAGNGNCCCNAAAAAACCNNTTCTTTGGGGNGNGNGTGGTTTTGTGTGTGGCGGTGAGAGTGCTGCCGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGTGAGTTTGGGATCGGTTCTTGCGGAGGAGGGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCA
  5   1   2   12  bld Gas7 5g3  in                         XZG59504.5p ........................................GATTGAGAGAGAGTAGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTTCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGTTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTG
  5   1   2       bld Egg  5g                        TEgg141m14.p1kSP6                                          CCGGGGAGAGAGTAAAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTCCTGGAGGAACATATCTTGCTGCTAAGAAGCAGTTGAACTGCCTTAAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCA
  5   1   2   12  bld Gas7 5g3  in                         XZG61229.5p .........................................ATTGAGAGAGAGTAGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCT
  5   1   2       bld Neu  5g3  in                   TNeu121m07.p1cSP6                                           TTGAGAGAGAGTGGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGA
  5   1   2   34  bld Brn3 5x3  out                         CAAK490.5p .............................................AGAGAGAGTAGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAA
  5   1   2   14  bld Gas6 5g3  in                         ANBT1636.5p ..............................................CAGAGAGTGGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGA
  5   1   2   14  bld Te4  5g3  in                         CAAN7734.5p ...............................................AGAGAGTAGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCNACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCACCCCTTGGAAACATC
  5   1   2       bld Gas  5g3  in                   TGas125f14.p1cSP6                                                    AGTAGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCAGACGCAGGTTTACTA
  5   1   2       bld Egg  FL   in                   TEgg062l20.p1kSP6                                                      TGGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGAC
  5   1   2   14  bld Te4  5g3  in                         CAAN7816.5p .....................................................TAGAGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCCTCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACC
  5   1   2       bld      FL                         IMAGE:7026526.5p                                                         GGGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCGGGTTTACTAAGCCAGCTTCATGGAGTGGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACCGAGGAGCTTCTGGGAACAGACAGTCCGACCCAGTTTAGGATTTTAATGAGCTGAAATGATGGGGAACGTCGGGAATCCCTTCTCCAAATTTCCTCCCACAATTCATGGGTTTAACCGAAATGGTTTAATATCAGAGCTGGGCCAATTCCCAGCAACCTTGGGTTTTTGTGTGCACACCCCCTTGGTGGAAAACAATCTCTTTTTAAAACCCCCCCGT
  5   1   2       bld Egg  5g                        TEgg127b12.p1kSP6                                                          GGAGTGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGG
  5   1   2   22  bld Gas7 5g                              XZG12939.5p .............................................................TGTGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTCACACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTTCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCACCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGNGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGC
  5   1   2       bld Neu  5g                        TNeu075g23.p1cSP6                                                                TGTGGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAACTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGACGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCTGGCAGGGGACACCCCCCGCAGGCTTGGAGAGAAGTTCCTGGAGGACAATATCTTGCTGCT
  5   1   2       bld Egg  5g                        TEgg021i14.p1kSP6                                                                   GGCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTG
  5   1   2   34  bld Brn3 5x3  out                       CAAK10255.5p ...................................................................GCGGTGAGAGTGCTGCGGTGCTGTCATGGGCTGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCT
  5   1   2   10  bld Ovi1 5g3  in                          CABI623.5p .........................................................................................CATCGATTCGGTTTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGACGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAGCACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAAC
  5   1   2   10  bld Lun1 5g3  in                         CABD1105.5p .....................................................................................................TTCGCTTAGCTGCTCGCCAGAGATTCAGCAAAGATGCGCCTAGCACTGCGCAGGAGAGGCTAAATCGCACGTTGTGCAAACTTGGTGCATTGTATCCGCTGACAAGTGGGAGTTTGGGATCGGTTCTTGCGGAATAGTGAGGATAAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTCGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAAT
  5   1   2       bld Gas8 5g                               st46l23.5p                                                                                                                                                                                                                                                    GATAGGATTACCTGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTTGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCAAAAAAAAAA
  5   1   2       bld Gas8 5g                               st43l23.5p                                                                                                                                                                                                                                                      AGGATTACCTGGCTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTTGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCAAAAAAAAAA
  5   1   2       bld Gas8 5g                               st44l23.5p                                                                                                                                                                                                                                                                  CTCATTGGAGCGCCCTTGTTCCTTTCCAGCCTGGCTGCCTTTGCAGATGCTCTAGCTTGTGGCTTGCTTGCTGTCCCAGGATGAAGCCGATCCCCGCCACCCCTGACCACCTGGGGCAACACCAGGAGAGCCCCCGCCGTAAGGACAAGGGAGAGGCGGAATCGGAGCGGCAGAGGACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCAAAAAAAA
  5   1   2       bld Egg                            TEgg110o22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACCCGGGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATA
  5   1   2       bld Egg       in                   TEgg062f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCGCCTGGAGGCGACCTTGGCCGGACTTGCGGAGCTGGGCTATCTCAGGCACCGGCAGGAGCTGCTGGTAAAGAGCGCACTTACCCCCGGGGCACCGACTCACGGAGATACTGCCACTCGGGCAGGGGACACCCCCCGCAGCCTGGAGGAGAAGTTCCTGGAGGACAATATCTTGCTGCTAAAGAAGCAGTTGAACTGCCTTAGAAAGCGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGAT
  5   1   2       bld Brn3      in                         CAAK6338.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGAGACGCAGGTTTACTAAGCCAGCTTCATGAGTTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGNGAGTATATGTGTCANACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTC
  5   1   2       bld Gas7                                 XZG11602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGACAAGCAAATAAACGATCTCAAAATTGATGTTGAAAAGACAGAGGAGCATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACTGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGNGAGTATATGTGTCANACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCCTGAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGG
  5   1   2       bld Gas8      in                          st97b10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTGGAAACAGACAGTCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAAC
  5   1   2       bld TbA       in                   TTbA002m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGGATTTTATGAGCTGAGTGATGGGACGTCGGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCANAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTA
  5   1   2       bld In63                            IMAGE:8960189.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCTTCCAATTCCTCCAACTCAGTTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGATGACTTCCTTGAATGGTTGGATTACAGAGACAGTCAACATGAAACGGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATATAGCACTTATCCTTCTCTAAAACAGTGCTCAAGGAGTCTCTAGTGACAGCTGAAAGTAAAGATGGCATCATCTCCACGTATCTTCTGTATGTCATGACTCAAGCAACATCAGATACTGTAAGCTTGTGTCAGCCTGCAAGGCTCTGTACATGACTCTATGTTCAAAGAAAGTA
  5   1   2       bld Gas                            TGas048g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGCACAGTTCGCCGTTCCTTTTCTGCACCACATTCCAACTCTGTTGACGTTGCAGCAGATGTTCACCCAAAGTATCAGTGTGATCTGGTATCTAAAAATGGCAACGATATCTACCGTTATCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGG
  5   1   2       bld Ova1      in                          CABE679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAGTCCTATGTTTCTTCTTTCTGTTATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGAGATTGGCCCCAATGATAATGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTTAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGA
  5   1   2       bld Neu       in                   TNeu088h16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGATGAAGACTCTTTTCTCCATCAAAGCAGCCTGTGTTCTTTACCACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTGGACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTGTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTGATGTGAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTACAATGACCTCAAATG
  5   1   2       bld Gas7      in                         XZG30075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTTTCTTCTGGGAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCCAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATA
  5   1   2       bld BrSp      in                     EC2BBA27AH12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGAAAAAAAATGGATGGGTACATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCGAACAGACTGGTGGTGTTTCTCAAAGCTGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGCTACGCCCAGTGCACCCAACT
  5   1   2       bld Egg       in                   TEgg019m21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGAATTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCAT
  5   1   2       bld Egg       in                   TEgg067f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGGTTTTACGACATGGGAGTATATGTGTCAAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTG
  5   1   2       bld Egg       in                   TEgg003h24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACAGACTGGTGGTGTTTCTCAAAGCAGCACAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGA
  3   1   2       bld BrSp      in                     EC2BBA30CG05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAA
  5   1   2       bld Egg                            TEgg140e21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGG
  5   1   2       bld Egg       in                   TEgg036a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAAC
  5   1   2       bld BrSp      in                     EC2BBA30CG05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAATGGAGTCTCTAAGTGAAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGC
  5   1   2       bld Gas7      in                          XZG5610.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCATCTCCCGTATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGTGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCCGGGCACGAAGA
  5   1   2       bld Gas7                                 XZG29884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAG
  5   1   2       bld Egg                            TEgg116l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAG
  5   1   2       bld Ova1      in                         CABE7175.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCGGAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCT
  5   1   2       bld Brn4      in                        CAAL20335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTTCTTACGCCCAGCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGC
  5   1   2       bld Ovi1      in                         CABI8617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAG
  5   1   2       bld Gas7      in                         XZG37417.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGAT
  5   1   2       bld Tad5      in                         XZT16062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGAAATGTTACGCCCAATGCACCAACTAATCTCTCTAATGCATCAAGTTCGGCCTGTAATGGATCTCCTAGAGAAAGTACGCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAG
  5   1   2       bld Neu       in                   TNeu114a03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGATGAGTGCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAAAATTTCCCCCAAAAATACACCTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATA
  5   1   2       bld Egg                            TEgg136b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGTTGTGCCACCAGTGAAAAAATTTCCCCCAAAATACACTCCTTTCTTATCATGCATCATCCTCTTTTGATGAAAGACCACCTTTGGATTTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCT
  5   1   2       bld Gas7      in                         XZG48868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGGACGCGTGGGCTTAAGAGCGAGGGATCGTCATCTCAGAGCTTGGATGAAGGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGANAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCAC
  5   1   2       bld Egg                            TEgg128d22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATCGTCATCTCAGAGCTTGGATGAAAGGCTGCTGGTCAATGCTCATTATATACCAGCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGT
  5   1   2       bld Egg                            TEgg116g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAATGCTCATTATATACCACCTCAGCAACAGGGTGTTAAACTTCATAAGAATATCAAAAATGTGAAGATTGTGAAGAGCTCCACTTTAAAACATAGGGCTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGA
  5   1   2       bld Gas7      in                         XZG18420.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAAGCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCT
  3   1   2       bld Te4  5g3  in                         CAAN7734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTTCAGTATGTGGCAGAAAATGGGTCCCAGACGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATT
  5   1   2       bld Gas7      in                         XZG63793.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGTGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATC
  5   1   2       bld Gas7                                 XZG15831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGAAAGAAAAATCCAAGGCTGTGGGAAAGAAGTGCAGGTTCCCTGAAGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCCACGGACTAAAAAAACGTCTCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGTGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCT
  5   1   2       bld Ova1      in                        CABE12382.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCACCCTAATTTTGAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGGCATCTGCAGATGTCCAATTAGACACATCCAGAATAGAC
  3  -1   2       bld Hrt1      in                         CAAQ9000.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGNCATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGAACAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACA
  5   1   2       bld Egg       in                   TEgg043l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACCTGCAGTAGTTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTT
  5   1   2       bld Egg       in                   TEgg043i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACCTGCAGTAGTTGGAAGAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATT
  5   1   2       bld Brn4      in                        CAAL21282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGAAGAAATCCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGNCATCTGCAGATGTCCAATTAGA
  5   1   2       bld Tad5      in                         XZT66749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGTTGCAGTCAGATCTGGAATCAAATCTCATGGACAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGTGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCNATTAGACACATCCAGAATAG
  5   1   2       bld Gas7      in                         XZG23555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCCAAAGGATGTGGTCTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTC
  5   1   2       bld Tad5      in                         XZT43951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGGCCAAACCCAAACATAAGAGAGGTGACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGTGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTTAGACCAGCAGCTTTTCATTTAGAAAATGGAGTGAAC
  5   1   2       bld Egg                            TEgg133d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTATCGGAGGTGGAAGTCTTCAGCTGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAAT
  3  -1   2       bld Sto1      in                         CABG1627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTTATGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTTCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAA
  3   1   2       bld Neu       in                    TNeu114a03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGAAGCATTAAGGCGGGCACGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGNAAAGAAGTACATGCAGTAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG40811.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCAT
  5   1   2       bld Egg       in                   TEgg027g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGACGAGCCCAGAGAGAAATGATGGGTGTTTATGCCCAAGTGCCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATC
  5   1   2       bld Egg       in                   TEgg073a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTACGCCAGCCCATACGCTGGCAATGTAAGCGTATGGGCTGGCGTAAGGAAACGGCACTTGGGCATACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCT
  5   1   2       bld Ova1      in                        CABE11187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGTTTCCTTACGCCAGCCCATACGCTTACATTGCCAGCGACTCTGAATACTCTGCCGAGTGTGAGTCTCTGTTTCACTCCACAGTTGTAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCCGTTTCTCTCTTCAAACCTATGCATGCACT
  5   1   2       bld Neu                            TNeu135m18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGTTTACTCCCAGTTGTAGACACCAGTGAGGATGAACACAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAAT
  5   1   2       bld BrSp      in                     EC2BBA28DD11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGAGACACCAGTGAGGATGAACAGAGCAATTACACCACAAACTGCTTTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAG
  3   1   2       bld Egg       in                    TEgg043i16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg043l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATGAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg062f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGATAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas125f14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTATGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTTTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTTTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTTTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATGAAACAAAATGAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg067f07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGACAGTGAATCCAGTTTGAGTGAGGTGAATTTGTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATGAAACAAAATGAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg036a09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTGAATCCAGTTTGAGTGAGGTGAAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg073a08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FL   in                    TEgg062l20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTGAATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTAAACAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG53264.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTGAATCGAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTTGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGANGTCATGTATACTTT
  3   1   2       bld Egg       in                    TEgg019m21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATCCAGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGTGAATACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTTTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTTTTCAAACCTATGCATGCACTGTGCATGAATTTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGA
  3   1   2      seed Ovi1      in                         CABI8617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTTTGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAGCCTCTCGCCCTA
  5   1   2       bld BrSp      in                     EC2BBA23AH02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAGTGAGGTTGAATTTGTTGGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACT
  3   1   2       bld Tad5      in                         XZT66749.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAAC
  3   1   2       bld Ova1      in                        CABE12382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAGCCTCTCG
  5  -1   2       bld Hrt1      in                         CAAQ9000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAAGTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTA
  5   1   2       bld Gas7      in                         XZG36042.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTACAACGTCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCATCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAGG
  3   1   2       bld Ova1      in                          CABE679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAAGTGATACGGATGAAAGTGGTGGACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  5   1   2       bld Gas7                                 XZG12575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGGTGGACTCATATGGTCCCGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAAT
  3   1   2       bld Ova1      in                        CABE11187.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAT
  3   1   2       bld Ova1      in                         CABE7175.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  3   1   2       bld Tad5      in                         XZT16062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  3   1   2       bld Brn3      in                         CAAK6338.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  3   1   2       bld Gas7      in                         XZG63793.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAAC
  3   1   2       bld Gas7      in                          XZG5610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAAC
  3   1   2       bld TbA                             TTbA063l04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATGGTCCCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTTTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATTTTTTTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTTTTTGGCAATTTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTTTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAAATAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTTTCTTTTCAAACCTATGCATGCACTGTGCATGAATTTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAAAAAAATAGCACATTTACATGGTAATAAATTGTATGCTTTAATGCTGTTTAAATTTATTAAATTGGAACACAAATGAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA23AH02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAAT
  3   1   2       bld Gas7 5g3  in                         XZG61229.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTTGTACATACCCTTCCCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAAGG
  5  -1   2       bld Sto1      in                         CABG1627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAT
  3   1   2       bld Gas7      in                         XZG36042.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCATCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAAC
  3   1   2       bld Lun1 5g3  in                         CABD1105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  3   1   2       bld Gas7      in                         XZG23555.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCAGGCCACTGCAACGGCTGAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn4      in                        CAAL20335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  3   1   2       bld Te4  5g3  in                         CAAN7816.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTG
  3   1   2       bld Gas7 5g3  in                         XZG59504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  3   1   2       bld Tad5      in                         XZT43951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAAC
  3   1   2       bld Gas8      out                         st71e22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACANTTTACATGGTAATAAATG
  3   1   2       bld Gas7      in                         XZG37417.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAACCACAGCAAAAGCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTTTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  3   1   2       bld TbA       in                    TTbA002m18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTTTGTTAAAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTTTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTTTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG48868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAAC
  3   1   2       bld Ovi1 5g3  in                          CABI623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAAGGCATCACACAACCTTAAGAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAACTTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  5   1   2       bld Neu                            TNeu016g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCATCACACAACCTTAAGAANAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACA
  3   1   2       bld Gas7      in                         XZG30075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGAAAATCCTCCGCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAAC
  3   1   2       bld Egg       in                    TEgg027g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCTACCAACTCCAGCTCCNATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn4      in                        CAAL21282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTCAGATCTGGATCTTTAAAGCTGATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  5   1   2       bld Brn3                                 CAAK4461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTGGATCTTTAAAGCTGATGACAANCTGTTTGAACATCACNCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGaaacaaaatgaaaaanaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Neu  5g3  in                    TNeu121m07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTAAAGCTGAGACAATGTTTGAACATCCCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st97b10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCNGATGACAACTGTTTGAACATCACCTTTTCACCAANTCCAGCTCCATTTTATTTTGNANATAATTGTGTTACTNTTGTGCAAATATTTAAAGTCTATGGTAAANTAAATTGACTCTCNTGNATATCCNTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTGTGCNTCCANTGTGCGCTTAAAGTGTCCNACATCGATGTTNTNTGGCAATCNGCAGATGTCCAATTAGACNCATCCNGAATAGGCCACCCAAGACCAGTGCAAACAGCAGTTGTAGAATGCTTGGTAANCANTCCATTAGAACCAGCAGNTTTTCATTTAGAAAATGGAGNGAACTTTNTNTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAANTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCACTTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTGTTAATCAC
  5   1   2       bld Gas7                                 XZG27168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGACAACTGTTTGAACATCACNCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA28DD11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAAT
  3   1   2       bld Neu       in                    TNeu088h16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACAACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATTTTTTTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTTTTTGGCAATTTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTTTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTTTTTCCAGCTAGAGGTGAAGTGGTTTAGAACTAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTTTTTTGCAATTGGAGTATAATTCCCCAGTTTTTTTTTTCAAACCTATGCATGCACTGTGCATGAATTTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTTTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACCAAATGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1                                 CBXT5861.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAACAATAAAAAAAAAAAAAAAAAAAATAA
  3   1   2       bld Egg       in                    TEgg003h24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTGTTTGAACATCACCTTTTCACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTTTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTTTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTTTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGaaacaaaatgaagaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Gas7      in                         XZG18420.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTACTTTTGTGCAAATATTTAAAGTCTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAAGG
  3   1   2       bld Gas6 5g3  in                         ANBT1636.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCAACTCCAGCTCCATTTTATTTTGTATATAATTTGTTTGTTTTGTGCAAATGTTTAAAGTGTATGGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAGCAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAAAGAAGTACATGCAGTT
  3   1   2       chi Egg       out                   TEgg062f17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATATTTAAAGTCCATGGTAAATAAAATTGACTCTCTGGAATATCCTTGTGGACCGTCAAAATTCCAACGAGCGCTGTAAATCCACGTAATTAATCTTTCTGCTTACATTGAGGGCTTAAAGTGTCCAACATGGATGTTATATCGCAATTTTCAGATGTCCAATTAGACACATCCAGAATAGACCGCCCCAGACCAGTGCAAACAGCAGTTATTGAATGCTTGGTAAACATTCCATTAGTACCAGCAGCTTTTCATTTAGAAAACGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTATTTCTTTCCAGCTAGAGATGAAGTGGTTTAGAATTACTGGTCCATTATGAGCTTTCCAAACAGACCCCCCCGTGCTATAATGAAATGGTTCCTCCCACTGGATTCTTCGGCGTCGCAGCGGAACAGATTGCACTTTTTTTTGTAGAGAAACAGAAAATTTAACTTATTTTACCTTAGGGATTTTTTTATTGTCATTATTTAACTTATCAGAAGGATTTTGTCATTGTATTTTTGTTTTACGAGAGTAACGACCTGCATCGGAAACCCTTGGAAATAAACATATTTTACCGTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG40811.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTAAATTAAATTGACTCTCTTGAATATCCTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  3   1   2       bld Gas7      in                         XZG53264.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGAATATCCTTGGGGGCTGTCAAAATTCCAATGACTGGGGTAAATCCCCGTAATTTATCTTTTTGCTTACATTGTGGGCTTAAAGTGTCCAACATCGATGTTTTTTGGCAATTTGCAGATGTCCAATTAGACCCATCCCGAATAGGCCCCCCAAGGCCAGGGCAAACAGCAGTTTTAGAATGCTTGGTAAACATTCCCTTAGAACCAGCAGCTTTTCATTTAGAAAAAGGGGGGAACTTTTTTTTTTATTTTTAACTGCATGTACTTTTTTCCAGCTAGAGCTGAAGGGGTTTAGAACTAGGGGTCCCTTTTGAGCTTTCCAAACCGGGGGTTTTTTGCAATTGGGGTATAATTCCCCAGTTTTTTTTTTCAAACCTATGCATGCCCTGGGCATGAATTTCATTGGTTACCATATGCCTTTCCCTATGGGGTTCAGGTATACTTTAATCCCTTGTATTTTATATATTTTGTAAATTATATAGCCCCTTTTCCAGGGTAATAAATTGTCTGCTTTAATGCGGTTTAAATTTTTTAAATT
  5   1   2       bld Tbd1                                CBXT20024.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGTGGACTGTCAAAATTCCAATGACTGGTGTAAATCCACGTAATTTATCTTTCTGCTTACATTGTGCGCTTAAAGTGTCCAACATCGATGTTCTCTGGCAATCTGCAGATGTCCAATTAGACACATCCAGAATAGACCACCCAAGACCAGTGCAAACAGCAGTTCTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  3   1   2       bld Eye                                  CCAX3918.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGATGTCCCAATTAGACACATCCCAGAATAGACCACCCCAAGACCAGTGCAAACAGCAGTTTTAGAATGCTTGGTAAACATTCCATTAGAACCAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTTTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTAAATTGAAACAAAATG
  5   1   2       bld Egg                            TEgg128o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGTTCTAGAATGCTTGGTAAACATTCCATTAAAAACAGCAGCTTTTCATTTAGAAAATGGAGTGAACTTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAACTGAAGTGGCTTAGAACTAATGGTCCATTCTGAGCTTTCCAAAACGTGTGTCTTTCGCAATTGGAGTATAAGTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACCTGAATCACTTGTATTTTATATATTTTGCAAATTATATAGCACATCTTACATGGTAATAAATTGTCTGCTTGAATGCTGTTTAAATTTATTAAATTG
  5   1   2       bld Egg                            TEgg088c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAACTAGTGTCGACGGGCCGCTTTTTTTTTTATTTTTAACTAGCGTGTGCTTCTTTCTACCTAGAGCTGAAGAGGGTTATAAATAGTGGGCCATTCTGAGCTTTCCCCACCCTGTGTCTTTCGCAATTGGAGAATAATTCCCCACTTTCTCTCTTGAAAACTATGCATGCACTGTGCATAAGTCTCATTGGTTACCACATGCCTCTCACTATGGAGAGCATGTGTACTTTAATCACTTGTATTTTATATATTTTGTGAATAATATATCACATTTTACATGGGAATAAATTG
  3   1   2       bld BrSp      in                     EC2BBA27AH12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTTTTTATTTTTAACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAAATAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTAAAAAAATTATATAGCACATTTTACATGGTAATA
  3  -1   2       bld Neu       in                    TNeu055p16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTTTTTTTTTTTTAACTGCATGTACTTCTTTCCGCTAGAGCCTACAAGCGCCGGAACTAGTGGTCCATTCTGAGCTTTCCAACCCCACGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTATTCCC
  3  -1   2       bld TbA  5g   out                   TTbA003d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTTTTTTTTTTTTTACTGCATGTACTTCTTTCCGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACCGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTG
  5  -1   2       bld Neu       in                   TNeu055p16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTGCATGTACTTCTTTCCAGCTAGAGCTGAAGTGGTTTAGAACTAGTGGTCCATTCTGAGCTTTCCAAACAGTGTGTCTTTCGCAATTGGAGTATAATTCCCCAGTTTCTCTCTTCAAACCTATGCATGCACTGTGCATGAATCTCATTGGTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTGTTTAAATTTA
  5  -1   2       bld Neu                            TNeu016n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACGGCATGGACTTTTTTCCAGCTAAAGCTTAAGTGGTTTAAAAATAGTGGTCCATTTTGAGCTTTCCAAACCGTGTGTTTTTTGCAATTGGAGGAAAATTCCCCAGTTTTTTTTTTCAAACCAAAGCAAGCCCTGGGCATGAATTTCATTGGTTACCAAAAGCCTTTCCCTATGGAGTTCATGGAAACTTTAAAAAAAAAAAATTTAAAAATTTTGTAAATTAAAAAGCCCATTTTACATGGGAAAAAATTGTTTGCTTTAAAGCTGTTTAAATTTATTAAATTGAAACCAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCGGCCGCGTCGACACTAG
  5   1   2       bld Egg       out                  TEgg070c18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTACCATATGCCTTTCACTATGGAGTTCATGTATACTTTAATCACTTGTATTTTATATATTTTGTAAATTATATAGCACATTTTACATGGTAATAAATTGTCTGCTTTAATGCTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)