Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   3.0    0Xt7.1-TEgg074a06.3.5                       52 END     1           1        2                LOC549181 protein [Xenopus tropicalis]
     2   0.5    0Xt7.1-CAAN7936.3                            8 END     2           2       25                Unknown (protein for IMAGE:7658732) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 53%

 1012071173 Xt7.1-XZT51688.5.5 - 96 ESTs
                                                                       .....-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT51688.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAATTATATTCCCATGTCACTAACCAGAGTAAACCTGCTGGCAGGGGCTTCAGTATGTTAATGACTATCCAGACATCTGAAGAAGCCAAGGGGCTCATTTACATTCTCATTCATTAGAGGATTGTTATACATAAGGATTTTATTACATGGCCAATTTAGTGTGTAAATGCAGTAGAAATGGAGGGGAAACAAAGAATCAGATTACTTGTCTGCCATTGTTTTATTTTTTGTCTGTAGGTTTCACACATCTATCAGACCAACAAAATCACTTTCTTTAATTATCCATCGTGGATTCTTAGCTTTTTCTTAATTTGATTTTATGTTGCAGGAACAATATTATCATGTGCCAGAATAGGTATTGAATATGACATAATGTGACACTTGTTTAGCATATCAAGTAAATTGTTCACA
                                                  Xt7.1-CHK-1008223337                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAxCAxxxGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAxxxxxxTTATATTCCCATGTCACTAACCAGAGTAAACCTGCTGGCAGGGGCTTCAGTATGTTAATGACTATCCAGACATCTGAAGAAGCCAAGGGGCTCATTTACATTCTCATTCATTAGAGGATTGTTATACATAAGGATTTTATTACATGGCCAATTTAGTGTGTAAATGCAGTAGAAATGGAGGGGAAACAAAGAATCAGATTACTTGTCTGCCATTGTTTTATTTTTTGTCTGTAGGTTTCACACATCTATCAGACCAACAAAATCACTTTCTTTAATTATCCATCGTGGATTCTTAGCTTTTTCTTAATTTGATTTTATGTTGCAGGAACAATATTATCATGTGCCAGAATAGGTATTGAATATGACATAATGTGACACTTGTTTAGCATATCAAGTAAATTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           2     4     5     6     5     7     7     8     8     9     8     9     9    10     9    10     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11    10    12    10    12    10    12    10    12    10    12    10    12    10    12    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    12    11    12    11    12    11    13    11    12    12    13    12    13    12    13    12    13    14    14    13    14    12    14    15    15    14    15    16    17    17    19    18    20    18    20    18    20    17    20    17    21    17    22    18    29    25    47    37    58    41    61    46    67    53    73    70    73    72    76    75    78    75    78    75    78    76    79    75    78    78    79    78    79    77    79    77    78    78    79    78    80    79    80    78    78    77    79    74    75    75    77    75    77    76    78    78    79    78    79    77    79    76    78    75    78    75    78    75    78    75    78    71    79    73    79    74    79    76    80    76    80    76    80    76    80    76    80    75    80    76    80    74    79    72    78    74    78    72    77    72    76    72    77    69    74    65    73    63    68    57    62    54    61    53    58    16    22    15    18     2     4     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     3     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
  5   1   2  SIG                                      Xt7.1-CABD6188.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAACCTCTTTATATTCCCATGTCACTAACCAGAGTAAACCTGCTGGCAGGGGCTTCAGTATGTTAATGACTATCCAGACATCTGAAGAAGCCAAGGGGCTCATTTACATTCTCATTCATTAGAGGATTGTTATACATAAGGATTTTATTACATGGCCAATTTAGTGTGTAAATGCAGTAGAAATGGAGGGGAAACAAAGAATCAGATTACTTGTCTGCCATTGTTTTATTTTTTGTCTGTAGGTTTCACACATCTATCAGACCAACAAAATCACTTTCTTTAATTATCCATCGTGGATTCTTAGCTTTTTCTTAATTTGATTTTATGTTGCAGGAACAATATTATCATGTGCCAGAATAGGTATTGAATATGACATAATGTGACACTTGTTTAGCATATCAAGTAAATTGT
  5   1   2  SIG                                      Xt7.1-XZT51688.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGACGCGTGGGCGGACGCGTGGGGAAGAGAAACTGGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGTCTCAATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---C--------
                                               BLH ATG     751      49                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN     751       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MPR     172       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR     751      10                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               CDS MIN     751       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               EST CLI     650      25                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG     751       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Dr ---- 1e-009     XP_706445.1 PREDICTED: hypothetical protein XP_701353 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 9e-017     NP_032085.1 G0/G1 switch gene 2 [Mus musculus] =================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Hs ==== 3e-019     NP_056529.1 putative lymphocyte G0/G1 switch gene [Homo sapiens] ===============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 5e-027     XP_001233638.1 PREDICTED: similar to Putative lymphocyte G0/G1 switch protein 2 isoform 1 [Gallus gallus] ======================================================================================================================================================================
                                                    Xt7.1-XZT51688.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTGA---------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------TGA------------------TAGTGA---------------------------------------------------TGA---TAG------------------------------------TAG------------------ATG---------------------------------------------------------TGA------------------------------------TAG---------------------------------------------------------TAG---------------------------------------------------------TAA------------TAA---------------ATG------------------------------------------------------------TAG---------------------------------------------------------------------------------TGA------ATG------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TGA------------------------------------------------------------------------------------TGA------------------ATG---------------------------------------------------------TGAATG---------------TAA------------------TAA------------------------------------------------------------------------ATG------------------------------------------TAATGA---------------------------------------------------------------------------------------------------TAAATG---TAG------------------------------------------------------------------------------------------------------------------------------------TAA---------ATG------------------------------TAG---------ATG---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                          ]
  5  -1   1         - Te4       out                        CAAN7936.5p CAGTTCCTTCCTGTGGTTCCATCTCTGCAATTGTCACACACACCCCCACTCACTCTGCCACTGGCTTCATACACAGCCGGGTCAAAGTGGCACTTATCAGCATGATTGTTACAGTTGCATCTTCTGCACTCATTTGGATAGTTGTCATCGGCTGGCCTCCAAGGCAAGTCATGAAAAAGGTCAGCACAACGTTCACAGTTTTCCCCAACAGTATTGTGCTGGCAAATACATTTATCATACACCTGAATTTCGCCATAGTGGTCTCTGTCCAGGGCACCACTTGGCATGCATCGATCTGCATGGCCATAACAGAAACAGCTGCCATGCACACGCATCACATCTACAGCATAAAATGTACTTGGTTCGCGATACCTCCGGGGAGGGAGACGCACAAGTTGTGTGAAATTCAGCCTCAGGTTGGTGAAATCTGCAAGGTGCTGGACTCTTTGACTGTGGGATAGAGGAACAGAGAAAGCCAGTTCCATTGGGCTGAATCGTATCTTGCCTCCTTGTGTGGGGTCTCCATGAAGCTCCTGGCATCGCACATCCTGCAAGTCGTATGGCACTCCCCGTCTGATGTGTGGGAAAGAGGCAGCACAGTCATAAGCCAAATACTGGTAAACCTGCCAGGTTTTCCCATGGTCTGAGGATCGTTCTATTAACATACTCGCTGGCCGAGGGCTCCTGAAATCCAGAATGACATCACTGAGCTGAAACTTTTTGTTCAGATCAAACTGCAGGGACACATCATTAATTCCATTGGAAGACTGCCACCAACGAAGATGGCCAGTGGGTGAGAGCACATTAGTGATTCGGTGACTAATCTCTGTAAAAGGCTGGCGCGAGTCACAGCGACAGCATTTCATCTGCATCATTTTCCCAGCAGTATACCCCCAACTCTTTGTAAACATTGCTGCTCTATGGGGG
  5   1   2  SIG                                      Xt7.1-CABD6188.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAACCTCTTTATATTCCCATGTCACTAACCAGAGTAAACCTGCTGGCAGGGGCTTCAGTATGTTAATGACTATCCAGACATCTGAAGAAGCCAAGGGGCTCATTTACATTCTCATTCATTAGAGGATTGTTATACATAAGGATTTTATTACATGGCCAATTTAGTGTGTAAATGCAGTAGAAATGGAGGGGAAACAAAGAATCAGATTACTTGTCTGCCATTGTTTTATTTTTTGTCTGTAGGTTTCACACATCTATCAGACCAACAAAATCACTTTCTTTAATTATCCATCGTGGATTCTTAGCTTTTTCTTAATTTGATTTTATGTTGCAGGAACAATATTATCATGTGCCAGAATAGGTATTGAATATGACATAATGTGACACTTGTTTAGCATATCAAGTAAATTGT
                                                  Xt7.1-CHK-1008279680                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAxAAxAxxxxxxCCTCTTTATATTCCCATGTCACTAACCAGAGTAAACCTGCTGGCAGGGGCTTCAGTATGTTAATGACTATCCAGACATCTGAAGAAGCCAAGGGGCTCATTTACATTCTCATTCATTAGAGGATTGTTATACATAAGGATTTTATTACATGGCCAATTTAGTGTGTAAATGCAGTAGAAATGGAGGGGAAACAAAGAATCAGATTACTTGTCTGCCATTGTTTTATTTTTTGTCTGTAGGTTTCACACATCTATCAGACCAACAAAATCACTTTCTTTAATTATCCATCGTGGATTCTTAGCTTTTTCTTAATTTGATTTTATGTTGCAGGAACAATATTATCATGTGCCAGAATAGGTATTGAATATGACATAATGTGACACTTGTTTAGCATATCAAGTAAATTGTTCACAA
  5   1   2       ext Neu       in                   TNeu056p21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTT
  5   1   2   12  ext Gas7 5g3  in                         XZG46753.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCACGCTTCCGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCAAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGC
  5   1   2       add AbdN 5g3  in                       IMAGE:7006920                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTTCGAATGGCACAGAGAATAATAAGCCTTTTTCTCTCCTTGTAGGTTGGGCTATCCCCAAGCATTTTTGACCCAATATGGGAAACCATCCACCGAACTGGATCCCATTTTGCCAAAGGAGATGCGTGAGCCCAGGAAACCCAAACAGAAAAAAATGGTGGAAAAATCTACGTTGGTTGGGGGCAAGTGTGGTTTAGCCCTTTTTTTTCG
  5   1   2       ext Gas8      in                          st20f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACA
  5   1   2       add Abd0                               IMAGE:7016770                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAATGAATAAAAACGCTCATAAAGGACACTGCTTTCAATACTAATTGCTGTTATATTACTGTATGTGTATCTGGTTCCTCCATATCCTAGTAATGCAGTACAGGATCATGAAATTTAATCCTTACTTATGCACATACTTATTTTTCTTTTTTCCAGGACACACATTACGCATATGCTCTCTCAGGGCCCCCTGTGTTCTATATAGTGCTGTAGCGGTTTATCTCGTCATACACATACTTCCAGTTATTTTTCTGATGTTGTT
  5   1   4      seed Lun1      in                         CABD6188.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCGAGGCTACCAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGNGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGA
  5   1   3        nb Lun1      in                         CABD7846.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACACAGCAGTACCGGACAACTATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCA
  5   1   3        nb Lun1      in                         CABD8899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCCTTTGGGTGAGCAGACATTACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGG
  5   1   3   10   nb Lun1 5g3  in                         CABD3477.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TACCTTTACCTTTCTAACCAATGGGTATACCTTGTGCTAGTGAGGGTGCAATGCTTGTTTCATTACTTACAGAATAGTTGCACTATTAGATAGAATTGTACTATTATTAGTATTGCACTAGAATTGTACTGAATTGCTAAACGTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGA
  5  -1   0       chi Brn3 FLt3 out                        CAAK7944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGTGTGGGAAAGAGGCAGCACAGTCATAAGCCAAATACTGGTAAACCTGCCAGGTTTTCCCATGGTCTGAGGATCGTTCTATTAACATACTCGCTGGCCGAGGGCTCCTGAAATCCAGAATGACATCACTGAGCTGAAACTTTTTGTTCAGATCAAACTGCAGGGACACATCATTAATTCCATTGGAAGACTGCCACCAACGAAGATGGCCAGTGGGTGAGAGCACATTAGTGATTCGGTGACTAATCTCTGTAAAAGGCTGGCGCGAGTCACAGCGACAGCATTTCATCTGCATCTCTCCATATGGGCTGCAGTAGGTTTCTGGCTTTTCAATGCCACATGTTGAGGAGGCTCTTAAGTAATTGCCTCTTCCAATGAGAAGGTCTCCAGCTGCAGGGTAGCACGCCCCACGGGAACAGTCATTCTGTGCATGCAGGAGGGTCGGTAAAACTAAAAGCAAAGCATATACCCACATGTCTGCTGCGGCACACCTGCACCTTACAGGAATCTGGGTCCTTGTAGCTAATGATACACACGTCTGTGGTTCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCAAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACCAGTGTGCAGTCCTTT
  5   1   2   10  ext Tbd1 5g3  in                         CBXT6296.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGTTCAATAGTGAGAGCCATCTGGCAGCCCTCCTGCATTTGCTGCATCAGGATCACTGGAAAGCTGAACATAGTGCAGCAGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAA
  5   1   3   32   nb Tad5 PIPE                            XZT20671.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGATGGAGGGCCCCCAAAGCTGCATTCCTATAGTTTTATATTTATTTGGAAATGCAATTGCCAGTAAAAACAGTATTTGGATATCCCTTTCTGTTCTGTGATTCTGACTTTTGAAACAATGTAACAGAAATCAGCTGGCTTCTGGTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACTGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCAAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAGACTGAAAGT
  3   1   2       add AbdN 5g3  in                       IMAGE:7006920                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAAAATCAGCCTGGCCTTCTGGTACCATAGGGGAGTCAGAACCTAGCAGGTGCAAAGAATAAAACCACCCAGAAGGACCACTGCTTTCAATAGCAATTGCATTTATATCACGGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTATCCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTCTTTTT
  3   1   4      seed Lun1      in                         CABD6188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTACATTAGGGAGTCAGAACTAGCAGTGCAAAGAATAAAAACACCCAGAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACNGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAG
  3   1   3        nb Lun1 5g3  in                         CABD3477.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAAGGACACTGCTTTCAATAGCAATTGCATTTATATCACGGTATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAACGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  3   1   3        nb Lun1      in                         CABD8899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTGTATTTGGTTCTCTATATACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  3   1   2       ext Gas7 5g3  in                         XZG46753.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCAAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  3   1   2       ext Tbd1 5g3  in                         CBXT6296.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAA
  3   1   3        nb Lun1      in                         CABD7846.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCGAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATA
  3   1   2       ext Neu       in                    TNeu056p21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCGCACTCTGTGAGGAAAAAGACTAAAAGTGGAAGTTTTGAGTCATGTAAAAAAAGAATGTGAGCGATTGCCTGTGAAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCATGCTGCCAGCTAACCCTTACTTTTTATATTATAAATACCGCCCGCTTGGGGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas8      in                          st20f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTGAAAGGGAAGTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAANCCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAGAACATGTCTGCCTCTTTATATTCCCATGTCACTAACCAGAGTAAACCTGCTGGCAGGGGCTTCAGTATGTTAATGACTATCCAGACATCTGAAGAAGCCAAGGGGCTCATTTACATTCTCATTCATTAGAGGATTGTTATACATAAGGATTTTATTACATGGCCAATTTAGTGTGTAAATGCAGTAGAAATGGAGGGGAAACAAAGAATCAGATTACTTGTCTGCCATTGTTTTATTTTTTGTCTGTAGGTTTCACACATCTATCAGACCAACAAAATCACTTTCTTTAATTATCCATCGTGGATTCTTAGCTTTTTCTTAATTTGATTTTATGTTGCAGGAACAATATTATCATGTGCCAGAATAGGTATTGAATATGACATAATGTGACACTTGTTTAGCATATCAAGTAAATTGTTCACAAGCTTACATGGCCATGTTGTTTGCTACAGACTGCGCCTTTAACAGAAGAGTCTGCAACCTGAAACTCCTAAAGGCTCTGGGCCATCAGAGAAAC
  5   1   3        nb Gas7                                 XZG16590.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCCAATTTAGTGTGTAAATGCAGTAGAAATGGAGAGGGAAACAAAGAATCAGATTACTTGTCTGCCATTGTTTTATTTTTTGTCTGGAGGTTTCACACATCTATCAGACCAACAAAATCACTTTCTTTAATTATCCATCGTGGATTCTTAGCTTTTTCTTAATTTGATTTTATGTTGCAGGAACAATATTATCATGTGCCAGAATAGGTATTGAATATGACATAATGTGACACTTGTTTAGCATATCAAGTAAATTGTTCACAAGCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGG
  5   1   2  SIG                                      Xt7.1-XZT51688.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGACGCGTGGGCGGACGCGTGGGGAAGAGAAACTGGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008279682                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTGGGCGGACGCGTGGGxxxxxGAAACTGGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAA
  5   1   2   12  add Gas7 5g3  in                         XZG32598.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACAGTACTTTATTTTAATCAGAGCATATTTAAAACAGAAATGTGCACATGCAGAAAATCCTGTTTCCATGTTTCCCAGTTTTAGCTTTACCTTTAATTCAGTGTAAACATGCTGCTTCTGTAACATCTCCCTTCCAAATGGCACAGAGAATAATAAGCCTTTTCTCTCTTGTAGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGANCTATTTATGGGCTATGCTGCCGTGCAGCTGTGCACATATTCCCTGTATGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCCTACTTTT
  5   1   2   12  add Gas7 5g3  in                          XZG1000.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGGGCTACAGCTCCTGCTACGTCACATGTGGGGCGGGACTTACTGGCTTAAAAGGACAGCGCTGTGGAAGATGCAGCAAGAGAAACTGGTCTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTA
  3   1   4      seed Tad5 5g3  in                         XZT51688.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGGTCTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATT
  5   1   4   12 seed Tad5 5g3  in                         XZT51688.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGGTCTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAGG
  3   1   3        nb BrSp 5g3  in                     EC2BBA22CF01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGAAGAGAAACTGGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCTCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACT
  5   1   3        nb BrSp 5g3  in                     EC2BBA22CF01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAAGAGAAACTGGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCTCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATAT
  3   1   3        nb HeRe 5g3  in                      EC2CAA5BG06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAGAGAAACTGGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTAAACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTAT
  5   1   3        nb HeRe 5g3  in                     EC2CAA31AD06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGAGAAACTGGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGTCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAGAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb HeRe 5g3  in                      EC2CAA5BG06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGAGAAACTGGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTAAACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAA
  3  -1   2       ext Gas7      in                         XZG40094.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGCGATCTAGAACTAGAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTANAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAAGGGCGGCGCCGCGATCTAGAACTAGCGGACGCGTGG
  5  -1   2       ext Gas7      in                         XZG40094.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGCGATCTAGAACTAGAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  3   1   3        nb Neu  5g3  in                    TNeu122e13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGTCTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTGAGAAC
  5   1   3   10   nb Bone 5g3  in                        CBTC6019.fwd ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCTCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTANAATAAATACTCTATTTTATTAT
  3   1   3        nb Bone 5g3  in                        CBTC6019.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCTCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  5   1   3   30   nb Tbd1 5x3                            CBXT16441.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAAATGTGTCAAACTACCAGCTAACCCTTACTTTTTTATATTATAAATACCTACTATATTTTTGCTTTAAAATAAAATACTCTATTTTATTATAGGAG
  5   1   3   10   nb Bone 5g3  in                        CBTC4055.fwd ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCTCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCANACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  3   1   3        nb Bone 5g3  in                        CBTC4055.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCTCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  5   1   3   10   nb Bone 5g3  in                        CBTC4914.fwd ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTANAATAAATACTCTATTTTATTAT
  3   1   3        nb Bone 5g3  in                        CBTC4914.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  5   1   3        nb Gas  5g                        TGas016a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTCAATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATA
  5   1   3        nb Neu  5g                        TNeu013p03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTNTNTATATTATAAATACCTACTATATTTTGCTTTAA
  5   1   3        nb Gas  5g3  in                   TGas051o15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACC
  5   1   3        nb Neu  5g3  in                   TNeu122e13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTA
  5   1   3        nb Neu  5x3                       TNeu040f24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCGATAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGANTGCTGACCAGAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTNTAAAATAAATACTCTATTTTATTAT
  5   1   3   12   nb Gas7 5g3  in                         XZG49645.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTAT
  3   1   3        nb Gas  5g3  in                    TGas086k10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTATGGTTTAAAATAAATACTCTATTTTATATAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tad5 5g3  in                         XZT41081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAC
  3   1   3        nb Tad5 5g3  in                         XZT44542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAACC
  5   1   3        nb Gas  5g3  in                   TGas086k10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAGTAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATT
  5   1   0       chi Gas       out                  TGas086k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACAGATGAATATGACCTGAATCCAGTAGAAACTACAAGTTCTCTACCTTTCCTTTAACTTGCCACACCAAATGCTTAACGCTGCCAAAATGTTTCCGTTGTCTTGGGGTGAGGACGATTTGCCAAAAAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGAGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAATCCTTTCTCTGGTCGGGAGGACACAGAG
  3   1   3        nb Gas7 5g3  in                         XZG42507.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCCGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATT
  5   1   3        nb Egg  5g                        TEgg109h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATAC
  5   1   3        nb Neu  5g3  in                   TNeu098i06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATG
  3   1   3        nb Neu  5g3  in                    TNeu098i06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas  5g                        TGas007m04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGTGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  5   1   3        nb Gas  5g3  in                   TGas080j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCT
  3   1   3        nb Gas  5g3  in                    TGas080j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAAAAA
  5   1   3   12   nb Tad5 5g3  in                         XZT41081.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAACAAAAAAAAAAAAAAAAAAAAAGG
  5   1   3   12   nb Tad5 5g3  in                         XZT44542.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCGAGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAACAAAAAAAAAAAAAAAAAAAAAGG
  5   1   3   10   nb Bone 5g3  in                        CBTC4655.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCTCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTANAATAAATACTCTATTTTATTAT
  3   1   3        nb Bone 5g3  in                        CBTC4655.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAGAGCTACAAAACCCTACACAGCAGTACTGGACAACTATTCCTTTGGGTTGGCTATCTCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  5   1   3        nb Gas  5g                        TGas022b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CNGNAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTAT
  5   1   3   12   nb Gas7 5g3  in                         XZG42507.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCCGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAGG
  5   1   3   10   nb Bone 5g3  in                        CBTC6254.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTACAAAACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTA
  5   1   3        nb Gas                            TGas044l13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACAAAACCCTACACAGCAGTACCGGGCAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  5   1   3   32   nb Gas7 5g                               XZG8615.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAGG
  3   1   3        nb Ova1 5g3  in                         CABE6670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAA
  5   1   3   10   nb Ova1 5g3  in                         CABE6670.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCCTACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAA
  5  -1   3        nb Egg                            TEgg079j08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACAGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAACCCGGG
  3  -1   3        nb Lun1      in                         CABD7718.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAA
  5  -1   3        nb Lun1      in                         CABD7718.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  3   1   3        nb Liv1 5g3  in                         CAAR2047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  5   1   3   10   nb Liv1 5g3  in                         CAAR2047.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGTACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAAA
  3   1   3        nb Sto1      in                         CABG7411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATA
  5   1   3        nb Sto1      in                         CABG7411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCGGACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATA
  3   1   3        nb Mus1 5g3  in                         CABH5733.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTT
  5   1   3   10   nb Mus1 5g3  in                         CABH5733.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACAACTATTCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTT
  3   1   3        nb Bone 5g3  in                        CBTC6254.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCTTTGGGTTGGCTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTTTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTTTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTTTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTTTTTTTTTTT
  3  -1   3        nb Mus1      in                        CABH11778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAAA
  5  -1   3        nb Mus1      in                        CABH11778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTATCCCAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  3   1   2       add Gas7 5g3  in                         XZG32598.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTATCCCAAGCATTTGACNCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCCGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTTTTAT
  5   1   3   30   nb Bone 5x3                            CBTC7323.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGCATTTTGACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTAT
  5   1   3        nb HeRe 5g                          EC2CAA29CF03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCAATATGGAAACCATCCACGAACTGATCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAAGCAAGTGGTTCCATTACCAGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGTGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTAT
  3   1   3        nb Gas  5g3  in                    TGas051o15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCCATTTGCCAAAGAGATGCTGAGCCAGAAACCCAACAGAAAAATGGTGAAAATCTACGTGTTGGGCAGTGTGTTAGCCTTTTTCGGAGTGGTCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG49645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGAAACCCAACAGAAAAATGGGGAAAATTTACGTGTTGGGCAGGGTGTTAGCCTTTTTCGGAGGGGTCATTGGGCGGGGGGAAACAGTGGGCAGTCCTTTTTTTGGTCGGGGGGCCCCCGGGGAAGGGGGGGGAAAGAATCAAGGGGTTCCATTACCAGGGCCAGTTCCCCAAACAAAACAGGGGGGGGTTTTTGAAAAAAGAAAGCCTCCCCCCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCTTCCTAAGGGCCCCCTTTGTGGGGAAAAAGACTGAAAGGGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTCCCTGTGAATGTGACTGTATCGGGATGTTGAACCCTTCTGGACTTATTTATGGCTATTGCTGCTGGGCAGCTGTGCCCATATTCCTGTATTGTACCCGTATGGGGGTACTGAATGTGTCAAACTCCCAGCTAACCCTTACTTTTTTTTTTATAA
  5  -1   3        nb Egg       out                  TEgg025d24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGGGGGTCATTGGGGTGGGGGAAACAGTGTGCAGTCCTTTCTTTGGTCGGGAGGACACAGAGGAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAATAAAAAAAAAAAAAAAAAAGCGGCCCCCGG
  5   1   3        nb Neu                            TNeu070p16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCATTGGGCTGGTGGAAACAGTGTGCAGTCCTTTCTCTGGTCGGGAGGACACATATGAAGATGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACATGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAATCATTGCAAACCGGGGACATGCATCCTAATGGCGCACTCTGTGATGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCATCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTA
  5   1   3        nb Gas       in                   TGas144l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCCGGGGGAAGAGGAGAGAAAGATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTAT
  3   1   3        nb Gas       in                    TGas144l17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAGGAGAGAAAGAATCAAGTGGTTCCATTACCAGTGCCAGTTCCCCAAACAAAACAGGAGGTGATCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATATAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu       out                  TNeu070p17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGTTCCATTACCATTGCCAAAAACCAAAACAAAACATGAGGTGGTCTTTGAAAAAATAAAGCCTCACAGCCTTGGGGCAAGAATCATTGCATACCGGGGACATGCATCCTAAAGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTTTTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTAACTTTCCGTATCATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTA
  3   1   3        nb HeRe 5g3  in                     EC2CAA31AD06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGCCAGTTCCCCAAACAAAACAGGAGGTGGTCTTTGAAAAAAGAAAGCCTCACAGCCTTGGGGCAAGAAGCATTGCAAACCGGGGACATGCATCCTAAGGGCGCACTCTGTGAGGAAAAAGACTGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCT
  5   1   3        nb Gas                            TGas085l20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGATGAAAGTGGAAGTTTTGAGTCATGTAAAGAAAGGATGTGAGCGATTGCCTGTGAATGTGACTGTATCGAGATGTTGAAACCTTCTGGACTTATTTATGGCTATTGCTGCTGTGCAGCTGTGCACATATTCCTGTATTGTACCCGTATGGTGGTACTGAATGTGTCCAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTA
  3   1   2       add Gas7 5g3  in                          XZG1000.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACTGAATGTGTCAAACTACCAGCTAACCCTTACTTTTTATATTATAAATACCTACTATATTTTGCTTTAAAATAAATACTCTATTTTATTATAGAACATGTCTGCCTCTTTATATTCCCATGTCACTAACCAGAGTAAACCTGCTGGCAGGGGCTTCAGTATGTTAATGACTATCCAGACATCTGAAGAAGCCAAGGGGCTCATTTACATTCTCATTCATTAGAGGATTGTTTTACATAGGGCAGGATTTTATTACATGGCCAATTTAGTGTGTAAATGCAGTAGAAATGGAGGGGAAACAAAGAATCAGATTACTTGTCTGCCATTGTTTTATTTTTTGTCTGTAGGTTTCACACATCTATCAGACCAACAAAATCACTTTCTTTAATTATCCATCGTGGATTCTTAGCTTTTTCTTAATTTGATTTTATGTTGCAGGAACAATATTATCATGTGCCAGAATAGGTATTGAATATGACATAATGTGACACTTGTTTAGCATATCAAGTAAATTGTTCACAAGCTTACATGGCCATGTTGTTTGCTACAGACTGCGCCTTTAACAGAAGAGTCTGCAACCTGAAACTCCTAAAGGCTCTGGGCCATCAGAGAAACAGTAAAAGCCTCACAATCACCACTCATTCTCTTGAATGGAAAACACAGAACTGGTATTTTCTTTTTTTATTTTAGCTCAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)